Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD61

Oligo Hamster Anti-Mouse CD61

Clone 2C9.G2 (also known as HMβ3-1)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Itgb3; Integrin beta-3; INGRB3; Platelet glycoprotein IIIa; GP3A; GPIIIa
16416
2 µl
Armenian Hamster IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTGATAAGGTGGATTCGGTAGTAGGGTAGTTCTCTG
AMM2089
Mouse T-cell Hybridoma 2B4 Vitronectin Receptor
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Illumina is a trademark of Illumina, Inc.
  8. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
940193 Rev. 1
Antibody Details
Down Arrow Up Arrow
2C9.G2

The 2C9.G2 monoclonal antibody specifically binds to the integrin β3 chain (CD61), which associates with the integrin αv chain (CD51) to form the vitronectin receptor, as well as the αIIb chain (CD41) to form the gpIIb/IIIa complex. Both receptors mediate adhesion to fibronectin, fibrinogen, vitronectin, thrombospondin, and von Willebrand factor. Leukocyte-endothelial adhesion is also mediated by the binding of αvβ3 integrin or vitronectin receptor to CD31 (PECAM-1). In addition, interaction of the αvβ3 integrin with its ligands regulates the L-type Ca2+ channel in vascular smooth muscle cells, possibly mediating vasodilatory responses to injury. Soluble and insoluble 2C9.G2 mAb mimics the effect of the natural ligands in smooth muscle cells from rat cremaster arterioles. Furthermore, osteopontin, also named Eta-1, is a cytokine that binds to αvβ3. CD61 is expressed on platelets, activated T lymphocytes, polymorphonuclear granulocytes, and blastocysts. Cross-reactivity of mAb 2C9.G2 to rat mast cells and platelets has been observed by flow cytometric analysis. mAb 2C9.G2 has been demonstrated to block binding of rat and mouse cells to fibronectin.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE:  The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

940193 Rev. 1
Format Details
Down Arrow Up Arrow
Antibody-Oligo
Antibody-Oligo
940193 Rev.1
Citations & References
Down Arrow Up Arrow

Development References (8)

  1. Ashkar S, Weber GF, Panoutsakopoulou V, et al. Eta-1 (osteopontin): an early component of type-1 (cell-mediated) immunity. Science. 2000; 287(5454):860-864. (Clone-specific: Blocking). View Reference
  2. Frieser M, Hallmann R, Johansson S, Vestweber D, Goodman SL, Sorokin L. Mouse polymorphonuclear granulocyte binding to extracellular matrix molecules involves beta 1 integrins. Eur J Immunol. 1996; 26(12):3127-3136. (Biology). View Reference
  3. Kieffer N, Phillips DR. Platelet membrane glycoproteins: functions in cellular interactions. Annu Rev Cell Biol. 1990; 6:329-357. (Biology). View Reference
  4. Moulder K, Roberts K, Shevach EM, Coligan JE. The mouse vitronectin receptor is a T cell activation antigen. J Exp Med. 1991; 173(2):343-347. (Biology). View Reference
  5. Piali L, Hammel P, Uherek C, et al. CD31/PECAM-1 is a ligand for alpha v beta 3 integrin involved in adhesion of leukocytes to endothelium. J Cell Biol. 1995; 130(2):451-460. (Clone-specific: Blocking). View Reference
  6. Schultz JF, Armant DR. Beta 1- and beta 3-class integrins mediate fibronectin binding activity at the surface of developing mouse peri-implantation blastocysts. Regulation by ligand-induced mobilization of stored receptor. J Biol Chem. 1995; 270(19):11522-11531. (Clone-specific: Blocking). View Reference
  7. Wu X, Mogford JE, Platts SH, Davis GE, Meininger GA, Davis MJ . Modulation of calcium current in arteriolar smooth muscle by alphav beta3 and alpha5 beta1 integrin ligands. J Cell Biol. 1998; 143(1):241-252. (Biology). View Reference
  8. Yasuda M, Hasunuma Y, Adachi H, et al. Expression and function of fibronectin binding integrins on rat mast cells.. Int Immunol. 1995; 7(2):251-8. (Immunogen: Flow cytometry, Functional assay, Immunofluorescence, Immunoprecipitation, Inhibition). View Reference
View All (8) View Less
940193 Rev. 1

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

Non-IVD products are For Research Use Only. Not for use in diagnostic or therapeutic procedures.

 

23-22940-00