Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD49a

BD™ AbSeq Oligo Hamster Anti-Mouse CD49a

Clone Ha31/8

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Itga1; Integrin alpha-1; Integrin α1; Laminin and collagen receptor; VLA-1a
2 µl
Armenian Hamster IgG2, λ1
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GATGGTAGTAGAACGGTCGGAGTGGTAGTCAATATG
AMM2050
Rat Emulsified Lewis Rat Glomeruli Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Illumina is a trademark of Illumina, Inc.
  8. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
940154 Rev. 1
Antibody Details
Down Arrow Up Arrow
Ha31/8

The Ha31/8 monoclonal antibody specifically binds to the 180-kDa integrin α1 chain (CD49a), which is a transmembrane glycoprotein that non-covalently associates with the integrin β1 subunit (CD29) to form the α1β1 (complex known as VLA-1).  VLA-1 has been reported to be expressed on activated T cells, monocytes, smooth muscle cells, and endothelial cells. It is a receptor for collagen and laminin. The Ha31/8 monoclonal antibody is specific for both rat and mouse CD49a. It has been reported that Ha31/8 antibody can block VLA-1-mediated binding of rat cells to collagen.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE:  The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

940154 Rev. 1
Format Details
Down Arrow Up Arrow
Antibody-Oligo
Antibody-Oligo
940154 Rev.1
Citations & References
Down Arrow Up Arrow

Development References (3)

  1. Hemler ME. VLA proteins in the integrin family: structures, functions, and their role on leukocytes. Annu Rev Immunol. 1990; 8:365-400. (Biology: Blocking). View Reference
  2. Mendrick DL, Kelly DM, duMont SS, Sandstrom DJ. Glomerular epithelial and mesangial cells differentially modulate the binding specificities of VLA-1 and VLA-2. Lab Invest. 1995; 72(3):367-375. (Immunogen). View Reference
  3. Miyake S, Sakurai T, Okumura K, Yagita H. Identification of collagen and laminin receptor integrins on murine T lymphocytes. Eur J Immunol. 1994; 24(9):2000-2005. (Biology). View Reference
940154 Rev. 1

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.