Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD16

BD™ AbSeq Oligo Mouse Anti-Human CD16

Clone 3G8

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD16;CD16A;FCGR3A;FcγRIIIA;FcRIIIa;CD16B;FCGR3B;FcγRIIIB;FcRIIIb
2214, 2215
2 µl
Mouse BALB/c x DBA/2, also known as CD2F1 or CDF1 IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAAATCTAATCGCGGTAACATAACGGTGGGTAAGGT
AHS0053
Human polymorphonuclear leukocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940006 Rev. 3
Antibody Details
Down Arrow Up Arrow
3G8

The 3G8 monoclonal antibody specifically recognizes CD16a and CD16b, low affinity receptors for the Fc region of IgG. CD16a is ~50-65 kDa type I transmembrane glycoprotein that is encoded by FCGR3A (Fc fragment of IgG receptor IIIa) which belongs to the immunoglobulin superfamily. CD16a is also known as Fc-gamma RIII-alpha (Fc-gamma RIIIa or FcγRIIIA) or FcRIIIa and is expressed on natural killer cells, activated monocytes, macrophages, γδ T cells, immature thymocytes, and mast cells. CD16a binds immune-complexed or aggregated IgG and associates with CD247/TCRζ in NK cells and FcεRIγ chains in phagocytes and mast cells to transduce intracellular signals. CD16a functions in antibody-dependent cellular cytotoxicity (ADCC) and other antibody-dependent responses including phagocytosis, cytokine production or mediator release. CD16b is a ~48 kDa glycophosyl-phosphatidylinositol (GPI)-linked form that is encoded by FCGR3B (Fc fragment of IgG receptor IIIb). CD16b is also known as Fc-gamma RIII-beta (Fc-gamma RIIIb or FcγRIIIB) or FcRIIIb and is expressed on neutrophils and activated eosinophils. The extracellular region of CD16b is highly homologous to CD16a. CD16b also serves as a receptor for the Fc region of IgG and can bind immune-complexed or aggregated IgG and may be involved in neutrophil adhesion.

       The 3G8 antibody also crossreacts with a subset of peripheral blood lymphocytes and monocytes, but not granulocytes, of baboon, rhesus, and cynomolgus monkeys. Multicolor analysis reveals that the distribution on lymphocytes is similar to that found in human studies with the majority of CD16-positive lymphocytes being both CD3 and CD20 negative.

940006 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940006 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (9)

  1. Fleit HB, Wright SD, Durie CJ, Valinsky JE, Unkeless JC. Ontogeny of Fc receptors and complement receptor (CR3) during human myeloid differentiation. J Clin Invest. 1984; 73(2):516-525. (Clone-specific: Flow cytometry, Fluorescence microscopy, Immunofluorescence, Immunoprecipitation, Radioimmunoassay). View Reference
  2. Fleit HB, Wright SD, Unkeless JC. Human neutrophil Fc gamma receptor distribution and structure. Proc Natl Acad Sci U S A. 1982; 79(10):3275-3279. (Immunogen: Blocking, Immunoprecipitation, Inhibition, Radioimmunoassay). View Reference
  3. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  4. Perussia B, Trinchieri G, Jackson A, et al. The Fc receptor for IgG on human natural killer cells: phenotypic, functional, and comparative studies with monoclonal antibodies. J Immunol. 1984; 133(1):180-189. (Clone-specific: Flow cytometry, Functional assay, Inhibition). View Reference
  5. Schmidt RE. Non-lineage/natural killer section report: new and previously defined clusters. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:517-542.
  6. Stroncek DF, Skubitz KM, Plachta LB, et al. Alloimmune neonatal neutropenia due to an antibody to the neutrophil Fc-gamma receptor III with maternal deficiency of CD16 antigen. Blood. 1991; 77(7):1572-1580. (Clone-specific: Immunofluorescence, Immunoprecipitation). View Reference
  7. Vossebeld PJ, Homburg CH, Roos D, Verhoeven AJ. The anti-Fc gamma RIII mAb 3G8 induces neutrophil activation via a cooperative actin of Fc gamma RIIIb and Fc gamma RIIa. Int J Biochem Cell Biol. 1997; 29(3):465-473. (Clone-specific: Activation, Functional assay). View Reference
  8. Wirthmueller U, Kurosaki T, Murakami MS, Ravetch JV. Signal transduction by Fc gamma RIII (CD16) is mediated through the gamma chain. J Exp Med. 1992; 175(5):1381-1390. (Clone-specific: Activation, Functional assay). View Reference
  9. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
View All (9) View Less
940006 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.