Product Details
BD™ AbSeq
TM; Thbd; fetomodulin; thrombomodulin
2 µl
Rat F344, also known as Fischer, CDF IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGGACGGAATGTATGTTGACGAAGTAAGAAGTAGCC
AMM2163
Mouse LyEnd.5 Cell Membranes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat
Preparation And Storage
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
Recommended Assay Procedures
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.
BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Product Notices
- This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
- Source of all serum proteins is from USDA inspected abattoirs located in the United States.
- Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
- The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
- Illumina is a trademark of Illumina, Inc.
- Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
- Please refer to bd.com/genomics-resources for technical protocols.
- For U.S. patents that may apply, see bd.com/patents.
Companion Products
Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block™) RUO
Size
0.1 mg
Cat No.
553141
Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block™) RUO
Size
0.5 mg
Cat No.
553142
Stain Buffer (FBS) RUO
Size
500 ML
Cat No.
554656
Single-Cell Analysis System RUO
Size
1 EA
Cat No.
633701
Express Single-Cell Analysis System Package RUO
Size
1 EA
Cat No.
633707
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
Size
1 Each
Cat No.
633772
940414 Rev. 2
Antibody Details
LS17-9
The LS17-9 monoclonal antibody specifically binds to CD141, also known as thrombomodulin (TM or TRBM) or fetomodulin. CD141 is encoded by Thbd and expressed as a type I transmembrane glycoprotein with an N-terminal C-type lectin domain followed by EGF-like repeats. CD141 is expressed on a variety of cells including endothelial cells, epithelial cells, mesothelial cells, keratinocytes, synovial lining cells, fibroblastic reticular cells, megakaryocytes, dendritic cells, monocytes, macrophages, neutrophils, precursor B cells, and hematopoietic progenitor cells. CD141 is required for normal fetal development. CD141 binds thrombin and this complex can activate Protein C and Thrombin activatable fibrinolysis inhibitor (TAFI), leading to anticoagulant and antifibrinolytic pathway activities.
940414 Rev. 2
Format Details
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940414 Rev.2
Citations & References
View product citations for antibody "940414" on CiteAb
Development References (4)
-
Conway EM, Pollefeyt S, Cornelissen J, et al. Structure-function analyses of thrombomodulin by gene-targeting in mice: the cytoplasmic domain is not required for normal fetal development.. Blood. 1999; 93(10):3442-50. (Biology). View Reference
-
Frontera V1, Arcangeli ML, Zimmerli C, et al. Cutting edge: JAM-C controls homeostatic chemokine secretion in lymph node fibroblastic reticular cells expressing thrombomodulin.. J Immunol. 2011; 187(2):603-607. (Immunogen: Cell separation, Flow cytometry, Fluorescence activated cell sorting, Fluorescence microscopy, Immunofluorescence, Immunoprecipitation). View Reference
-
Li YH, Kuo CH, Shi GY, Wu HL. The role of thrombomodulin lectin-like domain in inflammation.. J Biomed Sci. 2012; 19:34. (Biology). View Reference
-
Mionnet C, Mondor I, Jorquera A, et al. Identification of a new stromal cell type involved in the regulation of inflamed B cell follicles.. PLoS Biol. 2013; 11(10):e1001672. (Clone-specific: Fluorescence microscopy, Immunofluorescence). View Reference
940414 Rev. 2
Please refer to Support Documents for Quality Certificates
Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described
Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.
For Research Use Only. Not for use in diagnostic or therapeutic procedures.
Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.
Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.