Skip to main content Skip to navigation
Oligo Rat Anti-Human CD49f

BD™ AbSeq Oligo Rat Anti-Human CD49f

Clone GoH3

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
ITGA6; IThe GoH3 monoclonal ntegrin alpha-6; Integrin α6 chain; VLA-6; ITA6
3655
2 µl
Rat SD, also known as Sprague-Dawley (outbred) IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTGGTTTCTACTCGATGGGTTCTATATATGCGGACT
AHS0119
Mouse mammary tumor cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940160 Rev. 2
Antibody Details
Down Arrow Up Arrow
GoH3

The GoH3 monoclonal antibody specifically binds to CD49f which is also known as integrin α6 chain. CD49f is a ~150 kDa type I transmembrane glycoprotein that belongs to the integrin alpha chain family of extracellular matrix and cell adhesion receptors. The integrin α6 subunit associates with the integrin β1 chain (CD29) to form VLA-6 and with the integrin β4 chain (CD104) to form the integrin α6β4 complex, also known as the laminin and kalinin receptor. CD49f is expressed mainly on T cells, monocytes, platelets, epithelial cells, endothelial cells, perineural cells, and trophoblasts of placenta. GoH3 recognizes an extracellular epitope of integrin α6 on human, mouse and bovine cells. GoH3 has been reported to block the binding of integrin α6 to laminin P1 and E8 fragments.

940160 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940160 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (3)

  1. Aumailley M, Timpl R, Sonnenberg A. Antibody to integrin alpha 6 subunit specifically inhibits cell-binding to laminin fragment 8. Exp Cell Res. 1990; 188(1):55-60. (Biology). View Reference
  2. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  3. Sonnenberg A, Daams H, Van der Valk MA, Hilkens J, Hilgers J. Development of mouse mammary gland: identification of stages in differentiation of luminal and myoepithelial cells using monoclonal antibodies and polyvalent antiserum against keratin. J Histochem Cytochem. 1986; 34(8):1037-1046. (Immunogen: Immunohistochemistry, Radioimmunoassay). View Reference
940160 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.