Skip to main content Skip to navigation
Oligo Rat Anti-Human CD267

BD™ AbSeq Oligo Rat Anti-Human CD267

Clone 1A1-K21-M22 (also known as 1A1)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
TACI; TNFRSF13B; Tumor necrosis factor receptor 13B; TNFRSF14B2; CVID2
23495
2 µl
Rat IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATTGATTATATTCGGTGTCTGCGTAGGGATGGTCTG
AHS0207
Human TACI-transfected RBL cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940285 Rev. 2
Antibody Details
Down Arrow Up Arrow
1A1-K21-M22

The 1A1-K21-M22 monoclonal antibody specifically binds to CD267 which is also known as TACI (Transmembrane Activator and CAML Interactor). CD267 is a member of the of the Tumor Necrosis Factor Receptor (TNFR) Superfamily and is encoded by the TNFRSF13B gene. This 32 kDa type III transmembrane protein receptor binds to the ligands, BAFF (TNFSF13B/BLyS/CD257) and APRIL (TNFSF13/CD256). Ligand-bound CD267 transduces signals leading to the activation of transcription factors including NFAT, AP1, and NF-kappa-B. CD267 is expressed most notably on maturing subsets of B cells and myeloma cells. In CD267 deficient mice, B cell numbers are increased and mice develop autoimmune disorders suggesting that CD267 plays an important role in the regulation of B cell homeostasis.

940285 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940285 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (3)

  1. Ng LG, Sutherland AP, Newton R, et al. B cell-activating factor belonging to the TNF family (BAFF)-R is the principal BAFF receptor facilitating BAFF costimulation of circulating T and B cells.. J Immunol. 2004; 173(2):807-17. (Immunogen: ELISA, Flow cytometry). View Reference
  2. O'Connor BP, Raman VS, Erickson LD, et al. BCMA is essential for the survival of long-lived bone marrow plasma cells.. J Exp Med. 2004; 199(1):91-8. (Biology). View Reference
  3. Seshasayee D, Valdez P, Yan M, Dixit VM, Tumas D, Grewal IS.. Loss of TACI causes fatal lymphoproliferation and autoimmunity, establishing TACI as an inhibitory BLyS receptor. Immunity. 2003; 18(2):279-288. (Biology). View Reference
940285 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.