Skip to main content Skip to navigation
Oligo Rat Anti-Human CD132

BD™ AbSeq Oligo Rat Anti-Human CD132

Clone TUGh4 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
IL-2RG; IL-2Rγ; γc; Common γ chain; Common gamma chain; gamma c; SCIDX1
3561
2 µl
Rat IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CAGGGACCGTGATTGCGATTGTGGCGTATTTATTTC
AHS0144
Human γc Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940230 Rev. 2
Antibody Details
Down Arrow Up Arrow
TUGh4

The TUGh4 monoclonal antibody specifically binds to CD132. CD132 is a 65-70 kDa type 1 transmembrane glycoprotein that is encoded by the IL2RG (interleukin 2 receptor, gamma) gene. CD132 is also known as the common γ subunit (γc) and is shared by the IL-2, IL-4, IL-7, IL-9, IL-15 and IL-21 receptor complexes. CD132 is broadly expressed by most peripheral T and B lymphocytes, NK cells, monocytes, and granulocytes. The cytoplasmic domain of the γc chain plays an important role in cytokine-mediated signal transduction. Mutation of the IL2RG gene results in X-linked severe combined immunodeficiency (XSCID). The TUGh4 antibody recognizes a different epitope from that recognized by the CD132-specific clone, AG184.

940230 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940230 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940230" on CiteAb

Development References (4)

  1. Ishii N, Kondo M, Takeshita T, and Sugamura K. mAb specific for the γ chain of the IL-2 receptor. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:1867-1868.
  2. Ishii N, Takeshita T, Kimura Y, et al. Expression of the IL-2 receptor gamma chain on various populations in human peripheral blood. Int Immunol. 1994; 6(8):1273-1277. (Immunogen: Flow cytometry, Immunoprecipitation, Radioimmunoassay). View Reference
  3. Matsuoka M, Takeshita T, Ishii N, Nakamura M, Ohkubo T, Sugamura K. Kinetic study of interleukin-2 binding on the reconstituted interleukin-2 receptor complexes including the human gamma chain. Eur J Immunol. 1993; 23(10):2472-2476. (Biology). View Reference
  4. Tanaka N, Sugamura K. CD132 (interleukin 2 γ chain (common γ) Workshop Panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:861-864.
940230 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.