Skip to main content Skip to navigation
Oligo Mouse Anti-Human TLR4 (CD284)

BD™ AbSeq Oligo Mouse Anti-Human TLR4 (CD284)

Clone TF901 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
TLR4; CD284; Toll-like Receptor 4; ARMD10
7099
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGTCAGGTTAGATAGGTACGGAGATTCAAGAGCGCT
AHS0178
Human TLR4 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940508 Rev. 2
Antibody Details
Down Arrow Up Arrow
TF901

The TF901 monoclonal antibody specifically binds to TLR4 (Toll-like receptor 4) which is also known as CD284. TLR4 is a 110 kDa type I transmembrane glycoprotein that belongs to the Toll-like receptor (TLR) family. TLR4 is expressed on monocytes, macrophages, granulocytes, dendritic cells and endothelial cells. TLR4 binds lipopolysaccharide (LPS) which is a major membrane component of Gram-negative bacteria. It thus acts as an innate immune recognition receptor against many pathogens. In association with MD-2, LPS binds to and signals through TLR4 receptors by MyD88-dependent and MyD88-independent pathways to induce the cellular production of proinflammatory cytokines. TF901 antibody binding is not influenced by the human TLR4 D299G/T399I polymorphism. Preincubation of TLR4-positive cells with the TF901 antibody blocks the subsequent binding of the HTA125 antibody which is also specific for human TLR4.

940508 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940508 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940508" on CiteAb

Development References (7)

  1. Akashi S, Ogata H, Kirikae F, et al. Regulatory roles for CD14 and phosphatidylinositol in the signaling via toll-like receptor 4-MD-2. Biochem Biophys Res Commun. 2000; 268(1):172-177. (Biology). View Reference
  2. Akira S. Toll-like receptors and innate immunity. Adv Immunol. 2001; 78:1-56. (Biology). View Reference
  3. Beutler B. Tlr4: central component of the sole mammalian LPS sensor. Curr Opin Immunol. 2000; 12(1):20-26. (Biology). View Reference
  4. Rock FL, Hardiman G, Timans JC, Kastelein RA, Bazan JF. A family of human receptors structurally related to Drosophila Toll. Proc Natl Acad Sci U S A. 1998; 95(2):588-593. (Biology). View Reference
  5. Shimazu R, Akashi S, Ogata H, et al. MD-2, a molecule that confers lipopolysaccharide responsiveness on Toll-like receptor 4. J Exp Med. 1999; 189(11):1777-1782. (Biology). View Reference
  6. Yamakawa N, Ohto U, Akashi-Takamura S, et al. Human TLR4 polymorphism D299G/T399I alters TLR4/MD-2 conformation and response to a weak ligand monophosphoryl lipid A. Int Immunol. 2013; 25(1):45-52. (Immunogen: Bioassay, Blocking, Flow cytometry, Immunoprecipitation, Inhibition). View Reference
  7. Zarember KA, Godowski PJ. Tissue expression of human Toll-like receptors and differential regulation of Toll-like receptor mRNAs in leukocytes in response to microbes, their products, and cytokines. J Immunol. 2002; 168(2):554-561. (Biology). View Reference
View All (7) View Less
940508 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.