Skip to main content Skip to navigation
Oligo Mouse Anti-Human IgM

BD™ AbSeq Oligo Mouse Anti-Human IgM

Clone G20-127 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
IGHM; MU; Ig mu chain C region; AGM1; VH
3507
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTTGGAGGGTAGCTAGTTGCAGTTCGTGGTCGTTTC
AHS0198
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940276 Rev. 2
Antibody Details
Down Arrow Up Arrow
G20-127

IgM is an important component in the first line of defense against foreign pathogens, but may also play a role in autoimmune diseases.  IgM monomers consist of two light and two heavy chains.  Unlike the heavy chain of an IgG antibody which contains 3 constant Ig domains, the µ heavy chain of IgM contains 4 constant Ig domains.  Five IgM monomers complex with a small polypeptide (J-chain) to form pentameric IgM that can be found in human plasma.  In an immune response, the binding of IgM to a cell surface antigen enables C1q to activate interactions with downstream components in the classical complement pathway.  Mature B lymphocytes express IgM.  The G20-127 monoclonal antibody binds to the heavy chain of human IgM. The G20-127 antibody is not thought to react with other immunoglobulin heavy chain isotypes.

940276 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940276 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940276" on CiteAb

Development References (5)

  1. Chtanova T, Tangye SG, Newton R, et al. T follicular helper cells express a distinctive transcriptional profile, reflecting their role as non-Th1/Th2 effector cells that provide help for B cells. J Immunol. 2004; 173(1):68-78. (Clone-specific: Flow cytometry). View Reference
  2. Le Gallou S, Caron G, Delaloy C, Rossille D, Tarte K, Fest T. IL-2 requirement for human plasma cell generation: coupling differentiation and proliferation by enhancing MAPK-ERK signaling. J Immunol. 2012; 189(1):161-173. (Clone-specific: Flow cytometry). View Reference
  3. Mei HE, Yoshida T, Sime W, et al. Blood-borne human plasma cells in steady state are derived from mucosal immune responses. Blood. 2009; 113(11):2461-2469. (Clone-specific: Flow cytometry, Immunofluorescence). View Reference
  4. Widhopf GF, 2nd, Brinson DC, Kipps TJ, Tighe H. Transgenic expression of a human polyreactive Ig expressed in chronic lymphocytic leukemia generates memory-type B cells that respond to nonspecific immune activation. J Immunol. 2004; 172(4):2092-2099. (Clone-specific: Flow cytometry). View Reference
  5. Zola H, Macardle PJ, Flego L, Webster J. The expression of sub-population markers on B cells: a re-evaluation using high-sensitivity fluorescence flow cytometry. Dis Markers. 1991; 9(2):103-118. (Biology: Cell differentiation, Dot Blot, Flow cytometry, Fluorescence activated cell sorting, In situ hybridization). View Reference
940276 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.