Skip to main content Skip to navigation
Oligo Mouse Anti-Human IgD

BD™ AbSeq Oligo Mouse Anti-Human IgD

Clone IA6-2 (also known as δ-IA6-2; IADB6) (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
IGHD; Ig delta chain C region; Immunoglobulin heavy constant delta
3495
2 µl
Mouse BALB/c IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGAGGGATGTATAGCGAGAATTGCGACCGTAGACTT
AHS0058
Human IgD
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940026 Rev. 3
Antibody Details
Down Arrow Up Arrow
IA6-2

The IA6-2 monoclonal antibody specifically binds to the heavy chain of human Immunoglobulin D (IgD). IgD is a member of the immunoglobulin superfamily that exists in type 1-membrane (mIgD) and soluble glycoprotein forms. mIgD is expressed on mature naïve B cells (along with membrane IgM) and serves as a B-cell receptor for antigen (BCR).  In response to antigen binding, the mIgD BCR, in association with other signaling molecules including CD79a and CD79b, can transduce activating or tolerizing signals intracellularly into B lymphocytes.

940026 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940026 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940026" on CiteAb

Development References (5)

  1. Kruetzmann S, Rosado MM, Weber H, et al. Human immunoglobulin M memory B cells controlling Streptococcus pneumoniae infections are generated in the spleen. J Exp Med. 2003; 197(7):939-945. (Clone-specific: Flow cytometry). View Reference
  2. Odendahl M, Jacobi A, Hansen A, et al. Disturbed peripheral B lymphocyte homeostasis in systemic lupus erythematosus. J Immunol. 2000; 165(10):5970-5979. (Clone-specific: Flow cytometry). View Reference
  3. Preud'homme JL, Petit I, Barra A, Morel F, Lecron JC, Lelievre E. Structural and functional properties of membrane and secreted IgD. Mol Immunol. 2000; 37(15):871-887. (Biology). View Reference
  4. Wei C, Anolik J, Cappione A, et al. A new population of cells lacking expression of CD27 represents a notable component of the B cell memory compartment in systemic lupus erythematosus.. J Immunol. 2007; 178(10):6624-33. (Clone-specific: Flow cytometry). View Reference
  5. White MB, Shen AL, Word CJ, Tucker PW, Blattner FR. Human immunoglobulin D: genomic sequence of the delta heavy chain. Science. 1985; 228(4700):733-737. (Biology). View Reference
940026 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.