Skip to main content Skip to navigation
Oligo Mouse Anti-Human GITR (CD357)

BD™ AbSeq Oligo Mouse Anti-Human GITR (CD357)

Clone V27-580

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
GITR-D; TNFRSF18; activation-inducible TNFR family receptor; AITR
8784
2 µl
Mouse BALB/c IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TCTGTGTGTCGGGTTGAATCGTAGTGAGTTAGCGTG
AHS0104
Human GITR Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940096 Rev. 3
Antibody Details
Down Arrow Up Arrow
V27-580

The V27-580 monoclonal antibody specifically binds to GITR (Glucocorticoid-Induced Tumor necrosis factor Receptor), a member of the tumor necrosis factor receptor (TNFR) superfamily that is designated TNFRSF18. In the human, GITR is expressed at low levels in peripheral blood T cells, bone marrow, thymus, spleen, and lymph nodes and is up-regulated upon antigen stimulation or by treatment with anti-CD3 plus anti-CD28. GITR is also reported to be constitutively expressed on Treg cells. GITR's ligand (GITRL) is a member of the TNF superfamily, is designated TNFSF18, and is expressed on antigen presenting cells. The GITR cytoplasmic domain has striking homology with the cytoplasmic domains of the co-stimulatory receptors CD137 (4-1BB), CD134 (OX40) and CD27. GITR signaling is mediated by signaling adaptors, TNFR-associated factors (TRAFs), that affect signaling pathways (eg, Erk, JNK, MAPK and NF-κB) to enhance T-cell survival and cytokine production. The effects of GITR signaling upon the dynamic and interconnected roles of effector and regulatory T lymphocytes in the immune response are under investigation.

940096 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940096 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (7)

  1. Clouthier DL, Watts TH. Cell-specific and context-dependent effects of GITR in cancer, autoimmunity, and infection.. Cytokine Growth Factor Rev. 2014; 25(2):91-106. (Biology). View Reference
  2. Kwon B, Yu KY, Ni J, et al. Identification of a novel activation-inducible protein of the tumor necrosis factor receptor superfamily and its ligand.. J Biol Chem. 1999; 274(10):6056-61. (Biology). View Reference
  3. Li Z, Mahesh SP, Kim BJ, Buggage RR, Nussenblatt RB. Expression of glucocorticoid induced TNF receptor family related protein (GITR) on peripheral T cells from normal human donors and patients with non-infectious uveitis.. J Autoimmun. 2003; 21(1):83-92. (Biology). View Reference
  4. Nocentini G, Giunchi L, Ronchetti S, et al. A new member of the tumor necrosis factor / nerve growth factor receptor family inhibits T cell receptor-induced apoptosis... Proc Natl Acad Sci U S A. 1997; 94(12):6216-6221. (Biology). View Reference
  5. Pedroza-Gonzalez A, Zhou G, Singh SP, et al. GITR engagement in combination with CTLA-4 blockade completely abrogates immunosuppression mediated by human liver tumor-derived regulatory T cells ex vivo.. Oncoimmunology. 2015; 4(12):e1051297. (Biology). View Reference
  6. Placke T, Kopp HG, Salih HR. Glucocorticoid-induced TNFR-related (GITR) protein and its ligand in antitumor immunity: functional role and therapeutic modulation.. Clin Dev Immunol. 2010; 2010:239083. (Biology). View Reference
  7. Shevach EM, Stephens GL. The GITR-GITRL interaction: co-stimulation or contrasuppression of regulatory activity?. Nat Rev Immunol. 2006; 6(8):613-8. (Biology). View Reference
View All (7) View Less
940096 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.