Skip to main content Skip to navigation
Oligo Mouse Anti-Human Disialoganglioside GD2

BD™ AbSeq Oligo Mouse Anti-Human Disialoganglioside GD2

Clone 14.G2a (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
GD2; Disialoganglioside GD2; Ganglioside GD2
2 µl
Mouse BALB/c IgG2a
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CAGATCACAGTCGTAGTAAGAGTTCGTAAGGTAAGG
AHS0120
LAN-1 human neuroblastoma cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940205 Rev. 2
Antibody Details
Down Arrow Up Arrow
14.G2a

Gangliosides are sialic-acid bearing glycolipids that are expressed on the surface of all mammalian cells, and are likely involved in mediating cell-substratum interactions. They are important target antigens for antibody dependent cellular cytotoxicity (ADCC) of human melanoma and neuroblastoma cells. Human melanoma cells produce gangliosides, designated as GD2 and GD3 which are deposited in the subtratum-attached material, and may play a significant role in the melanoma metastatic phenotype. Clone 14.G2a specifically reacts with human and mouse GD2 ganglioside. LAN-1 human neuroblastoma cells were used as immunogen. Clone 14.G2a is an isotype switch variant selected from the parental IgG3-producing hybridoma 14.18 and has identical reactivity as the parental antibody. Clone 14.G2a is routinely tested by flow cytometry using M21 human melanoma cells.

940205 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940205 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940205" on CiteAb

Development References (6)

  1. Cheresh DA, Klier FG. Disialoganglioside GD2 distributes preferentially into substrate-associated microprocesses on human melanoma cells during their attachment to fibronectin. J Cell Biol. 1986; 102(5):1887-1897. (Biology). View Reference
  2. Frost JD, Hank JA, Reaman GH, et al. A phase I/IB trial of murine monoclonal anti-GD2 antibody 14.G2a plus interleukin-2 in children with refractory neuroblastoma: a report of the Children's Cancer Group. Cancer. 1997; 80(2):317-333. (Clone-specific: Cytotoxicity, In vivo exacerbation). View Reference
  3. Hakomori S. Tumor-associated carbohydrate antigens. Annu Rev Immunol. 1984; 2:103-126. (Biology). View Reference
  4. Lode HN, Reisfeld RA, Handgretinger R, Nicolaou KC, Gaedicke G, Wrasidlo W. Targeted therapy with a novel enediyene antibiotic calicheamicin theta(I)1 effectively suppresses growth and dissemination of liver metastases in a syngeneic model of murine neuroblastoma. Cancer Res. 1998; 58(14):2925-2928. (Clone-specific: Cytotoxicity, In vivo exacerbation). View Reference
  5. Mujoo K, Cheresh DA, Yang HM, Reisfeld RA. Disialoganglioside GD2 on human neuroblastoma cells: target antigen for monoclonal antibody-mediated cytolysis and suppression of tumor growth. Cancer Res. 1987; 47(4):1098-1104. (Immunogen: ELISA, Flow cytometry, Immunohistochemistry). View Reference
  6. Mujoo K, Kipps TJ, Yang HM, et al. Functional properties and effect on growth suppression of human neuroblastoma tumors by isotype switch variants of monoclonal antiganglioside GD2 antibody 14.18. Cancer Res. 1989; 49(11):2857-2861. (Clone-specific: Cytotoxicity, In vivo exacerbation). View Reference
View All (6) View Less
940205 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.