Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD98

BD™ AbSeq Oligo Mouse Anti-Human CD98

Clone UM7F8

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
SLC3A2; CD98HC; 4F2; 4F2hc; MDU1; NACAE; 4T2HC
6520, 8140
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTTGGCGTTAGGTGTCGATTGTATGGGTTATGCTGC
AHS0100
Human T-leukemic and Thymic Cell Lines
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940093 Rev. 3
Antibody Details
Down Arrow Up Arrow
UM7F8

CD98 is a disulfide-linked heterodimer composed of a ~80-85 kDa, type II membrane glycoprotein heavy chain, (CD98hc), and ~40-45 kDa light chain. The UM7F8 monoclonal antibody specifically recognizes CD98hc, which is also known as 4F2 heavy chain antigen (4F2hc). CD98 is broadly expressed on hematopoietic cells, including peripheral blood lymphocytes, monocytes and granulocytes (low), as well as non-hematopoietic cells, eg, intestinal epithelial cells. CD98 expression is upregulated on activated and proliferating cells. CD98hc is encoded by the SLC3A2 [solute carrier family 3 (amino acid transporter heavy chain), member 2] gene. CD98 reportedly functions in transmembrane amino acid transport and in the regulation of integrin signaling which are involved in the regulation of cellular activation, proliferation, and survival. The UM7F8 antibody is reportedly a functional antibody that can costimulate T cell proliferative responses.

940093 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940093 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (6)

  1. Cantor JM, Ginsberg MH. CD98 at the crossroads of adaptive immunity and cancer. J Cell Sci. 2012; 125(Pt 6):1373-1382. (Biology). View Reference
  2. Diaz LA, Friedman AW, Jawanda JS, Fox DA. A functional role for the 4F2 antigen-CD98 in T-lymphocyte activation. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:281-283.
  3. Freidman AW, Diaz LA, Jr., Moore S, Schaller J, Fox DA. The human 4F2 antigen: evidence for cryptic and noncryptic epitopes and for a role of 4F2 in human T lymphocyte activation. Cell Immunol. 1994; 154(1):253-263. (Immunogen: (Co)-stimulation, Flow cytometry, Immunoprecipitation). View Reference
  4. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  5. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  6. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
View All (6) View Less
940093 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.