Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD96

BD™ AbSeq Oligo Mouse Anti-Human CD96

Clone 6F9

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
TACTILE; T cell activation increased late expression
10225
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CTAATGTAAGAGCGGACGTTTGGGCACTATATGTTT
AHS0194
Human CD96 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940272 Rev. 2
Antibody Details
Down Arrow Up Arrow
6F9

The 6F9 monoclonal antibody specifically binds to human CD96, also known as TACTILE (T cell activation increased late expression). CD96 is a type I transmembrane glycoprotein and member of the Ig superfamily. CD96 is expressed at low levels on resting natural killer (NK) cells and T cells and at high levels on activated NK and T cells. CD96 is also expressed on some T-cell leukemia and acute myeloid leukemia cells. CD96 may serve as a marker for acute myelogenous leukemia stem cells. CD96 plays a role in the adhesive interactions of activated NK and T cells during immune responses. CD96 binds to the poliovirus receptor (CD155) that is highly expressed by some tumor cells. CD155-mediated ligation of CD96 can induce NK cell-mediated cytotoxicity. CD96-mediated uptake of CD155 may adversely affect NK cells and thus reduce their effectiveness in anti-tumor responses.

940272 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940272 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (4)

  1. Fuchs A, Cella M, Giurisato E, Shaw AS, Colonna M. Cutting edge: CD96 (tactile) promotes NK cell-target cell adhesion by interacting with the poliovirus receptor (CD155).. J Immunol. 2004; 172(7):3994-8. (Biology). View Reference
  2. Hosen N, Park CY, Tatsumi N, et al. CD96 is a leukemic stem cell-specific marker in human acute myeloid leukemia. Proc Natl Acad Sci U S A. 2007; 104(26):11008-11013. (Biology). View Reference
  3. Majeti R. Monoclonal antibody therapy directed against human acute myeloid leukemia stem cells. Oncogene. 2011; 30(9):1009-1019. (Biology). View Reference
  4. Wang PL, O'Farrell S, Clayberger C, Krensky AM. Identification and molecular cloning of tactile. A novel human T cell activation antigen that is a member of the Ig gene superfamily. J Immunol. 1992; 148(8):2600-2608. (Biology). View Reference
940272 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.