Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD8

BD™ AbSeq Oligo Mouse Anti-Human CD8

Clone SK1 (also known as Leu-2a; Leu2a)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD8α; CD8A; CD8 alpha; Leu2a; MAL; T8; p32
925
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGGACATAGAGTAGGACGAGGTAGGCTTAAATTGCT
AHS0228
Human Peripheral Blood T Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940305 Rev. 2
Antibody Details
Down Arrow Up Arrow
SK1

The SK1 monoclonal antibody specifically binds to CD8 alpha (CD8α). CD8α is a type I transmembrane glycoprotein and a member of the immunoglobulin superfamily. CD8α is expressed by the majority of thymocytes, by subpopulations of  αβ T cells and γδ T cells and by some NK cells. Cell surface CD8α is expressed either as a disulfide-linked homodimer (CD8αα) or as a heterodimer (CD8αβ) when disulfide-bonded to a CD8 beta chain (CD8β). CD8-positive αβ T cells coexpress both CD8αα homodimers and CD8αβ heterodimers whereas some γδ T cells and NK cells express CD8αα homodimers.  CD8 plays important roles in T cell activation and selection. The extracellular IgSF domain of CD8α binds to a non-polymorphic determinant on HLA class I molecules (α3 domain) and enables CD8 to function as a co-receptor with MHC class I-restricted TCR during T cell recognition of antigen. The cytoplasmic domain of CD8α associates with Lck, a Src family protein tyrosine kinase that is involved in intracellular signaling.

940305 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940305 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (9)

  1. Bernard A, Boumsell L, Hill C. Joint report of the first international workshop on human leucocyte differentiation antigens by the investigators of the participating laboratories: T2 protocol. In: Bernard A. A. Bernard .. et al., ed. Leucocyte typing : human leucocyte differentiation antigens detected by monoclonal antibodies : specification, classification, nomenclature = Typage leucocytaire : antigènes de différenciation leucocytaire humains révélés par les anticorps monoclonaux : "Rapports des études communes". Berlin New York: Springer-Verlag; 1984:25-60.
  2. Dongworth DW, Gotch FM, Carter NP, Hildreth PDK, McMichael AJ. Inhibition of virus-specific, HLA-restricted, T cell-mediated lysis by monoclonal anti-T cell antibodies. In: Bernard A. A. Bernard .. et al., ed. Leucocyte typing : human leucocyte differentiation antigens detected by monoclonal antibodies : specification, classification, nomenclature = Typage leucocytaire : antigènes de différenciation leucocytaire humains révélés par les anticorps monoclonaux : "Rapports des études communes". Berlin New York: Springer-Verlag; 1984:320-328.
  3. Engleman EG, Benike CJ, Glickman E, Evans RL. Antibodies to membrane structures that distinguish suppressor/cytotoxic and helper T lymphocyte subpopulations block the mixed leukocyte reaction in man. J Exp Med. 1981; 154(1):193-198. (Clone-specific: Cell separation, Flow cytometry, Functional assay, Inhibition). View Reference
  4. Engleman EG, Benike CJ, Grumet FC, Evans RL. Activation of human T lymphocyte subsets: helper and suppressor/cytotoxic T cells recognize and respond to distinct histocompatibility antigens. J Immunol. 1981; 127(5):2124-2129. (Clone-specific: Cell separation, Flow cytometry, Fluorescence activated cell sorting). View Reference
  5. Evans RL, Wall DW, Platsoucas CD, et al. Thymus-dependent membrane antigens in man: inhibition of cell-mediated lympholysis by monoclonal antibodies to TH2 antigen. Proc Natl Acad Sci U S A. 1981; 78(1):544-548. (Immunogen: Flow cytometry, Functional assay, Inhibition). View Reference
  6. Jonker M, Meurs G. Monoclonal antibodies specific for B cells, cytotoxic/suppressor T cells, and a subset of cytotoxic/suppressor T cells in the Rhesus monkey. In: Bernard A. A. Bernard .. et al., ed. Leucocyte typing : human leucocyte differentiation antigens detected by monoclonal antibodies : specification, classification, nomenclature = Typage leucocytaire : antigènes de différenciation leucocytaire humains révélés par les anticorps monoclonaux : "Rapports des études communes". Berlin New York: Springer-Verlag; 1984:328-336.
  7. Ledbetter JA, Evans RL, Lipinski M, Cunningham-Rundles C, Good RA, Herzenberg LA. Evolutionary conservation of surface molecules that distinguish T lymphocyte helper/inducer and cytotoxic/suppressor subpopulations in mouse and man. J Exp Med. 1981; 153(2):310-323. (Clone-specific: Flow cytometry, Immunoprecipitation). View Reference
  8. McMichael AJ. A.J. McMichael .. et al., ed. Leucocyte typing III : white cell differentiation antigens. Oxford New York: Oxford University Press; 1987:1-1050.
  9. Warner NL, Lanier LL, Jackson A, Babcock G, Evans R. Multiparameter approaches to FACS analysis of human leucocyte cell surface antigens. In: Bernard A. A. Bernard .. et al., ed. Leucocyte typing : human leucocyte differentiation antigens detected by monoclonal antibodies. Berlin New York: Springer-Verlag; 1984:621-630.
View All (9) View Less
940305 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.