Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD58

BD™ AbSeq Oligo Mouse Anti-Human CD58

Clone 1C3 (also known as AICD58.6)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
LFA-3; LFA3; Lymphocyte function-associated antigen 3; Ag3
965
2 µl
Mouse BALB/c IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTGGTGAGTATTGGTGCGTAGTATGCGGGATGTTTG
AHS0237
Recombinant Human CD58
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940371 Rev. 2
Antibody Details
Down Arrow Up Arrow
1C3

The 1C3 (AICD58.6) monoclonal antibody specifically binds to CD58. CD58 is a a 60-70 kDa glycoprotein member of the immunoglobulin superfamily. CD58, also referred to as the lymphocyte function-associated antigen-3 (LFA-3), has a wide tissue distribution, being expressed on both hematopoietic and non-hematopoietic cells, including endothelial cells and fibroblasts. There are two isoforms of CD58: a glycosylphosphatidylinositol (GPI)-linked form and a transmembrane form. Both isoforms may be expressed on the same cell type. Erythrocytes, however, only express the GPI-linked isoform. CD58 interacts with CD2 during cell adhesion. This binding can enhance antigen-specific T-cell activation. This interaction can also play a role in cell-mediated cytotoxicity.

940371 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940371 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (5)

  1. Dengler TJ, Hoffmann JC, Knolle P, et al. Structural and functional epitopes of the human adhesion receptor CD58 (LFA-3). Eur J Immunol. 1992; 22(11):2809-2817. (Immunogen: Bioassay, Blocking, ELISA, Flow cytometry, Functional assay, Inhibition, Western blot). View Reference
  2. Framson PE, Cho DH, Lee LY, Hershberg RM. Polarized expression and function of the costimulatory molecule CD58 on human intestinal epithelial cells. Gastroenterology. 1999; 116(5):1054-1062. (Clone-specific: Flow cytometry, Immunofluorescence, Immunoprecipitation, Inhibition). View Reference
  3. Lin G-X, Yang X, Hollemweguer E, et al. Cross-reactivity of CD antibodies in eight animal species. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:519-523.
  4. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  5. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
940371 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.