Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD56

BD™ AbSeq Oligo Mouse Anti-Human CD56

Clone NCAM16.2 (also known as NCAM 16)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
NCAM1; NCAM-1; NCAM; Leu-19; Neural cell adhesion molecule 1; NKH1; MSK39
4684
2 µl
Mouse BALB/c IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGAGGTTGAGTCGTAATAATAATCGGAAGGCGTTGG
AHS0019
Immunoaffinity-enriched adult human brain NCAM
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940007 Rev. 3
Antibody Details
Down Arrow Up Arrow
NCAM16.2

The NCAM16.2 monoclonal antibody specifically binds to human CD56. It recognizes an extracellular immunoglobulin-like domain common to 120, 140, and 180 kDa forms of CD56, also known as the neural cell adhesion molecule (NCAM), NKH1 or MSK39. The CD56 antigen is expressed on approximately 10% to 25% of peripheral blood lymphocytes. It is present on essentially all resting and activated CD16+ natural killer (NK) lymphocytes and approximately 5% of CD3+ peripheral blood lymphocytes. CD3+ CD56+ T lymphocytes comprise a unique subset of cytotoxic T lymphocytes that mediates non-major histocompatibility complex (MHC)-restricted cytotoxicity. CD56 antigen density on NK lymphocytes increases upon cellular activation. The CD56 antigen is involved in neuronal homotypic cell adhesion and cell differentiation during embryogenesis. CD16+ CD56+ NK cells demonstrate reciprocal transfer of an activation state with dendritic cells.

940007 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940007 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (14)

  1. Bennett IM, Zatsepina O, Zamai L, Azzoni L, Mikheeva T, Perussia B. Definition of a natural killer NKR-P1A+/CD56-/CD16- functionally immature human NK cell subset that differentiates in vitro in the presence of interleukin 12. J Exp Med. 1996; 184(5):1845-1856. (Biology). View Reference
  2. Campbell JJ, Qin S, Unutmaz D, et al. Unique subpopulations of CD56+ NK and NK-T peripheral blood lymphocytes identified by chemokine receptor expression repertoire. J Immunol. 2001; 166(11):6477-6482. (Biology). View Reference
  3. Cooper MA, Fehniger TA, Caligiuri MA. The biology of human natural killer–cell subsets. Trends Immunol. 2001; 22(11):633-640. (Biology). View Reference
  4. Cunningham BA, Hemperly JJ, Murray BA, Prediger EA, Brackenbury R, Edelman GM. Neural cell adhesion molecule: structure, immunoglobulin-like domains, cell surface modulation, and alternative RNA splicing. Science. 1987; 236(4803):799-806. (Biology). View Reference
  5. Edelman GM. Cell adhesion molecules in the regulation of animal form and tissue pattern. Annu Rev Cell Biol. 1986; 2:81-116. (Biology). View Reference
  6. Galandrini R, Tassi I, Mattia G, et al. SH2-containing inositol phosphatase (SHIP-1) transiently translocates to raft domains and modulates CD16-mediated cytotoxicity in human NK cells. Blood. 2001; 100(13):4581-4589. (Biology). View Reference
  7. Gerosa F, Baldani-Guerra B, Nisii C, Marchesini V, Carra G, Trinchieri G. Reciprocal activating interaction between natural killer cells and dendritic cells. J Exp Med. 2002; 195(3):327-333. (Biology). View Reference
  8. Lanier LL, Chang C, Azuma M, Ruitenberg JJ, Hemperly JJ, Phillips JH. Molecular and functional analysis of human natural killer cell-associated neural cell adhesion molecule (N-CAM/CD56). J Immunol. 1991; 146(12):4421-4426. (Immunogen: ELISA, Flow cytometry). View Reference
  9. Lanier LL, Le AM, Civin CI, Loken MR, Phillips JH. The relationship of CD16 (Leu-11) and Leu-19 (NKH-1) antigen expression on human peripheral blood NK cells and cytotoxic T lymphocytes. J Immunol. 1986; 136(12):4480-4486. (Biology). View Reference
  10. Lanier LL, Testi R, Bindl J, Phillips JH. Identity of Leu-19 (CD56) leukocyte differentiation antigen and neural cell adhesion molecule. J Exp Med. 1989; 169(6):2233-2238. (Biology). View Reference
  11. Nitta T, Yagita H, Sato K, Okumura K. Involvement of CD56 (NKH-1/Leu-19 antigen) as an adhesion molecule in natural killer–target cell interaction. J Exp Med. 1989; 170(5):1757-1761. (Biology). View Reference
  12. Phillips JH, Lanier LL. Dissection of the lymphokine-activated killer phenomenon: relative contribution of peripheral blood natural killer cells and T lymphocytes to cytolysis. J Exp Med. 1986; 164(3):814-825. (Biology). View Reference
  13. Ritz J, Trinchieri G, Lanier LL. NK-cell Antigens: Section Report. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:1367-1372.
  14. Schubert W, Zimmermann K, Cramer M, Starzinski-Powitz A. Lymphocyte antigen Leu-19 as a molecular marker of regeneration in human skeletal muscle. Proc Natl Acad Sci U S A. 1989; 86(1):307-311. (Biology). View Reference
View All (14) View Less
940007 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.