Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD335 (NKp46)

BD™ AbSeq Oligo Mouse Anti-Human CD335 (NKp46)

Clone 9E2/NKp46 (also known as 9-E2)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
NCR1; NK-p46; hNKp46; LY94; Natural cytotoxicity triggering receptor 1
9437
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CAATTTGTTCGCGTTTAGTAGTCGTCGTCTTATGGG
AHS0068
Human NKp46 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940064 Rev. 3
Antibody Details
Down Arrow Up Arrow
9E2/NKp46

The 9E2/Nkp46 monoclonal antibody specifically binds to CD335. CD335 is also known as the Natural killer cell p46-related protein (NKp46) and the Natural cytotoxicity triggering receptor 1 (NCR1). CD335 is a 46 kDa type I membrane glycoprotein that is expressed on resting and activated NK cells. Its extracellular region contains two C2-type, Ig-like domains. The transmembrane domain contains a positively charged amino acid (Arg) which could be involved in stabilizing the association with CD3ζ. Its intracellular region does not contain immunoreceptor tyrosine-based activating motifs (ITAM), but it is linked to intracytoplasmic transduction machinery by its association with CD3ζ and FcεRIγ adaptor proteins. CD335 along with NKp30 and NKp44 are referred to as natural cytotoxicity receptors (NCR). These receptors play very important roles in cells that kill virus-infected target cells, tumor cells and MHC-class I-unprotected cells.

940064 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940064 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (4)

  1. Mandelboim O, Porgador A. NKp46. Int J Biochem Cell Biol. 2001; 33(12):1147-1150. (Biology). View Reference
  2. Nakajima H, Cella M, Bouchon A, et al. Patients with X-linked lymphoproliferative disease have a defect in 2B4 receptor-mediated NK cell cytotoxicity. Eur J Immunol. 2000; 30(11):3309-3318. (Immunogen: Flow cytometry, Functional assay). View Reference
  3. Sivori S, Pende D, Bottino C, et al. NKp46 is the major triggering receptor involved in the natural cytotoxicity of fresh or cultured human NK cells. Correlation between surface density of NKp46 and natural cytotoxicity against autologous, allogeneic or xenogeneic target cells. Eur J Immunol. 1999; 29(5):1656-1666. (Biology). View Reference
  4. Sivori S, Vitale M, Morelli L, et al. p46, a novel natural killer cell-specific surface molecule that mediates cell activation. J Exp Med. 1997; 186(7):1129-1136. (Biology). View Reference
940064 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.