Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD325

BD™ AbSeq Oligo Mouse Anti-Human CD325

Clone 8C11

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Cadherin-2, N-Cadherin; NCAD; CDHM; CDH2
1000
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAGGATGAGTTTCGTAAGTAAGGTAGTCGTATGGCT
AHS0223
Human extracellular N-Cadherin domain Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940300 Rev. 2
Antibody Details
Down Arrow Up Arrow
8C11

The 8C11 monoclonal antibody recognizes the extracellular domain of human N-Cadherin (CD325). Cadherins are a family of Ca2+ -dependent intercellular adhesion molecules that play a central role in controlling morphogenetic movements during development. Their function is regulated by association with the actin cytoskeleton by a complex of cytoplasmic proteins called the catenins (α, β, γ). Members of the cadherin family include P-cadherin , E-cadherin (uvomorulin), N-cadherin (neural cadherin), R-cadherin, cadherin 5, L-CAM, and EP-cadherin. N-cadherin mRNA is found at elevated levels in brain and heart and at a much lower level in liver. Mechanisms such as mRNA expression, cytokine modulation, and protease-mediated turnover modulate N-cadherin protein levels during development. In addition, N-cadherin function is indirectly regulated by endogenous kinases and phosphatases. Tyrosine phosphorylation of β-catenin complexed with N-cadherin results in dissociation of N-cadherin from actin. However, N-cadherin also interacts with a PTP1B-like phosphatase that dephosphorylates β-catenin and promotes N-cadherin/actin association. Thus, N-cadherin is an integral adhesion molecule whose function is regulated by protein-protein interactions and phosphorylation/dephosphorylation events.

940300 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940300 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (4)

  1. Kim JB, Islam S, Kim YJ, et al. N-Cadherin extracellular repeat 4 mediates epithelial to mesenchymal transition and increased motility. J Cell Biol. 2000; 151(6):1193-1206. (Immunogen: Functional assay, Immunofluorescence, Inhibition, Western blot). View Reference
  2. Knudsen KA, Soler AP, Johnson KR, Wheelock MJ. Interaction of alpha-actinin with the cadherin/catenin cell-cell adhesion complex via alpha-catenin. J Cell Biol. 1995; 130:66-77. (Biology). View Reference
  3. Puch S, Armeanu S, Kibler C, et al. N-cadherin is developmentally regulated and functionally involved in early hematopoietic cell differentiation. J Cell Sci. 2001; 114(8):1567-1577. (Clone-specific: Flow cytometry). View Reference
  4. Wein F, Pietsch L, Saffrich R, et al. N-Cadherin is expressed on human hematopoietic progenitor cells and mediates interaction with human mesenchymal stromal cells. Stem Cell Res. 2010; 4(2):129-139. (Clone-specific: Flow cytometry). View Reference
940300 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.