Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD32

BD™ AbSeq Oligo Mouse Anti-Human CD32

Clone 3D3

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
FcγRII; CD32a/FcγRIIa/FCGR2A; CD32b/FcγRIIb/FCGR2B
2212
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTGGATGGTGGAACGTCGGCTTAATAGATGTCAGTC
AHS0222
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940299 Rev. 2
Antibody Details
Down Arrow Up Arrow
3D3

The 3D3 monoclonal antibody specifically recognizes FcγRII (CD32), a 40 kDa, polymorphic type I transmembrane glycoprotein that serves as a low affinity receptor for aggregated IgG. This highly glycosylated molecule (encoded by at least two different genes) is expressed on monocytes, granulocytes, platelets and B cells. Unlike the FLI28.26 mAb, the 3D3 mAb detected a polymorphic CD32 antigen expressed on B cells of all donors, but only on platelets, monocytes and granulocytes of some donors. The platelets from 3D3+ donors respond to certain stimulatory mAb such as CD165 (clone SN2) which results in aggregation. On the other hand, the platelets from 3D3 negative donors do not form aggregates after stimulation. Individuals can be divided into two groups as responder and non-responder depending on expression, or non-expression, of 3D3. In comparison to the 3D3 mAb, the FLI8.26 mAb detects a monomorphic CD32 antigen expressed on all human donors.

940299 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940299 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (5)

  1. Boruchov AM, Heller G, Veri MC, Bonvini E, Ravetch JV, Young JW. Activating and inhibitory IgG Fc receptors on human DCs mediate opposing functions.. J Clin Invest. 2005; 115(10):2914-23. (Clone-specific: Flow cytometry). View Reference
  2. Dai X, Jayapal M, Tay HK, et al. Differential signal transduction, membrane trafficking, and immune effector functions mediated by FcgammaRI versus FcgammaRIIa.. Blood. 2009; 114(2):318-27. (Clone-specific: Activation, Calcium Flux, Functional assay). View Reference
  3. Dutertre CA, Bonnin-Gélizé E, Pulford K, Bourel D, Fridman WH, Teillaud JL. A novel subset of NK cells expressing high levels of inhibitory FcgammaRIIB modulating antibody-dependent function.. J Leukoc Biol. 2008; 84(6):1511-20. (Clone-specific: Flow cytometry). View Reference
  4. Gosselin EJ, Brown MF, Anderson CL, Zipf TF, Guyre PM. The monoclonal antibody 41H16 detects the Leu 4 responder form of human Fc gamma RII. J Immunol. 1990; 144(5):1817-1822. (Biology). View Reference
  5. Vely F, Gruel N, Moncuit J, et al. A new set of monoclonal antibodies against human Fc gamma RII (CD32) and Fc gamma RIII (CD16): characterization and use in various assays.. Hybridoma. 1997; 16(6):519-28. (Immunogen: Immunoprecipitation). View Reference
940299 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.