Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD31

BD™ AbSeq Oligo Mouse Anti-Human CD31

Clone L133.1 (RUO)

940236
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
EndoCAM; GPIIA'; PECA1; PECAM1; Platelet endothelial cell adhesion molecule
5175
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGTGTGGTATAAGTCGGTGTCTAGGATTGGCTGTTT
AHS0150
Purified Human Natural Killer Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940236 Rev. 2
Antibody Details
Down Arrow
L133.1

The L133.1 monoclonal antibody specifically recognizes CD31, the platelet/endothelial cell adhesion molecule-1 (PECAM-1), a 130 to 140-kilodalton (kDa) single-chain integral membrane glycoprotein that is a member of the immunoglobulin gene superfamily. The CD31 antigen is composed of six extracellular immunoglobulin-like domains belonging to the C2 group. C2 domains are also found in other members of the immunoglobulin superfamily, the cell adhesion molecules (CAMs). The CD31 antigen functions as a vascular cell adhesion molecule and is involved in the process of leucocyte migration through the intercellular junctions of vascular endothelial cells. It may also be involved in thrombosis, angiogenesis, wound healing, and inflammation. The CD31 antigen is expressed on endothelial cells, platelets, T-lymphocyte subsets, monocytes, and granulocytes. The CD31 antigen has also been found in metastatic colon carcinoma. The CD31 antigen is the only known member of the CAM family to be expressed on platelets. The antigen is localized at regions of cell-cell contacts and may function as an adhesion molecule, mediating adhesion between leucocytes/endothelial cells, leucocytes/platelets, and endothelial cells/endothelial cells.

940236 Rev. 2
Citations & References
Down Arrow

Development References (11)

  1. Albelda SM, Buck CA. Integrins and other cell adhesion molecules.. FASEB J. 1990; 4(11):2868-80. (Biology). View Reference
  2. Albelda SM, Muller WA, Buck CA, Newman PJ. Molecular and cellular properties of PECAM-1 (endoCAM/CD31): a novel vascular cell-cell adhesion molecule.. J Cell Biol. 1991; 114(5):1059-68. (Biology). View Reference
  3. Bordessoule D, Jones M, Gatter KC, Mason DY. Immunohistological patterns of myeloid antigens: tissue distribution of CD13, CD14, CD16, CD31, CD36, CD65, CD66 and CD67.. Br J Haematol. 1993; 83(3):370-83. (Biology). View Reference
  4. Fawcett J, Buckley C, Holness CL, et al. Mapping the homotypic binding sites in CD31 and the role of CD31 adhesion in the formation of interendothelial cell contacts. J Cell Biol. 1995; 128(6):1229-1241. (Clone-specific: Blocking, ELISA, Functional assay). View Reference
  5. Horak ER, Leek R, Klenk N, et al. Angiogenesis, assessed by platelet/endothelial cell adhesion molecule antibodies, as indicator of node metastases and survival in breast cancer.. Lancet. 1992; 340(8828):1120-4. (Biology). View Reference
  6. Metzelaar MJ, Korteweg J, Sixma JJ, Nieuwenhuis HK. Comparison of platelet membrane markers for the detection of platelet activation in vitro and during platelet storage and cardiopulmonary bypass surgery.. J Lab Clin Med. 1993; 121(4):579-87. (Biology). View Reference
  7. Muller WA, Weigl SA, Deng X, Phillips DM. PECAM-1 is required for transendothelial migration of leukocytes. J Exp Med. 1993; 178(2):449-460. (Biology). View Reference
  8. Newman PJ, Berndt MC, Gorski J, et al. PECAM-1 (CD31) cloning and relation to adhesion molecules of the immunoglobulin gene superfamily.. Science. 1990; 247(4947):1219-22. (Biology). View Reference
  9. Simmons DL, Walker C, Power C, Pigott R. Molecular cloning of CD31, a putative intercellular adhesion molecule closely related to carcinoembryonic antigen. J Exp Med. 1990 June; 171(6):2147-2152. (Biology). View Reference
  10. Stockinger H, Gadd SJ, Eher R, et al. Molecular characterization and functional analysis of the leukocyte surface protein CD31. J Immunol. 1990 December; 145(11):3889-3897. (Biology). View Reference
  11. Tawia SA, Beaton LA, Rogers PA. Immunolocalization of the cellular adhesion molecules, intercellular adhesion molecule-1 (ICAM-1) and platelet endothelial cell adhesion molecule (PECAM), in human endometrium throughout the menstrual cycle.. Hum Reprod. 1993; 8(2):175-81. (Biology). View Reference
View All (11) View Less
940236 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.