Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD275

BD™ AbSeq Oligo Mouse Anti-Human CD275

Clone 2D3/B7-H2 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
ICOSLG; ICOS ligand; LICOS; B7-H2; B7 homolog 2; B7RP-1; GL50
23308
2 µl
Mouse IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTTTATATGTACGACGCCCGGTTGACGAGTGGAAGT
AHS0011
Human B7-H2
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940091 Rev. 3
Antibody Details
Down Arrow Up Arrow
2D3/B7-H2

The 2D3 monoclonal antibody specifically binds to CD275, which is also known as B7 homolog 2 (B7-H2/B7H2) and B7-related protein 1 (B7RP-1). CD275 is a type I transmembrane glycoprotein that belongs to the Ig superfamily. CD275 is likewise known as Inducible T-cell co-stimulator ligand (ICOS Ligand /ICOSLG/ICOS-L). It can bind to CD278 (ICOS) and costimulate the proliferation and cytokine production of antigen-stimulated human T cells. CD275 is variable expressed by subsets of B cells, monocytes, macrophages, dendritic cells and endothelial cells.

940091 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940091 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940091" on CiteAb

Development References (6)

  1. Bretscher PA. A two-step, two-signal model for the primary activation of precursor helper T cells. Proc Natl Acad Sci U S A. 1999; 96(1):185-190. (Biology). View Reference
  2. Cabezon R, Sintes J, Llinas L, Benitez-Ribas D. Analysis of HLDA9 mAbs on plasmacytoid dendritic cell. Immunol Lett. 2011; 134(2):167-173. (Clone-specific: Flow cytometry). View Reference
  3. Dong H, Zhu G, Tamada K, Chen L. B7-H1, a third member of the B7 family, co-stimulates T-cell proliferation and interleukin-10 secretion. Nat Med. 1999; 5(12):1365-1369. (Biology). View Reference
  4. Kurosawa S, Myers AC, Chen L, et al. Expression of the costimulatory molecule B7-H2 (inducible costimulator ligand) by human airway epithelial c. Am J Respir Cell Mol Biol. 2003; 28(5):563-573. (Clone-specific: Flow cytometry). View Reference
  5. Llinas L, Lazaro A, de Salort J, Matesanz-Isabel J, Sintes J, Engel P. Expression profiles of novel cell surface molecules on B-cell subsets and plasma cells as analyzed by flow cytometry. Immunol Lett. 2011; 134(2):113-121. (Clone-specific: Flow cytometry). View Reference
  6. Wang S, Zhu G, Chapoval AI, et al. Costimulation of T cells by B7-H2, a B7-like molecule that binds ICOS. Blood. 2000; 96(8):2808-2813. (Biology). View Reference
View All (6) View Less
940091 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.