Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD134

BD™ AbSeq Oligo Mouse Anti-Human CD134

Clone ACT35 (also known as Ber-ACT35)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
OX40; TNFRSF4; TXGP1L; OX40L Receptor
7293
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGTGTTGGTAAGACGGACGGAGTAGATATTCGAGGT
AHS0013
Human HUT 102
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940060 Rev. 3
Antibody Details
Down Arrow Up Arrow
ACT35

The ACT35 monoclonal antibody specifically binds to CD134 which is also known as OX40. The 35 kDa CD134 polypeptide is encoded by the TNFRSF4 gene. CD134 is a type I integral membrane glycoprotein and member of the tumor necrosis factor/nerve growth factor receptor (TNFR/NGFR) family. CD134 is expressed on activated T lymphocytes, hematopoietic precursor cells and fibroblasts. CD134 functions as a T cell costimulatory receptor when bound by OX40 Ligand/TNFSF4 that is expressed by antigen presenting cells. CD134 thereby plays roles in T-cell activation as well as the regulation of differentiation, proliferation or apoptosis of normal and malignant lymphoid cells. Analysis of the nucleotide sequence of the human TNFRSF4 cDNA reveals strong homology with the rat Tnfrsf4 cDNA sequence. OX40 was clustered as CD134 in the Sixth International Workshop on Human Leukocyte Differentiation Antigens.

940060 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940060 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (7)

  1. Harrop JA, Spampinato J, Reddy M, Eichman C, Cook R, Truneh A. CD134 Workshop: Kinetics of expression of tumor necrosis factor receptor molecules and other cytokine receptors on activated CD4-positive cells. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:871-873.
  2. Latza U, Durkop H, Schnittger S, et al. The human OX40 homolog: cDNA structure, expression and chromosomal assignment of the ACT35 antigen. Eur J Immunol. 1994; 24(3):677-683. (Clone-specific: Western blot). View Reference
  3. Merl A, Pohla H, Adibzadeh M, Paelec G. CD13r Workshop: Expression of cytokine receptors on anergic CD4-positive TCR2-positive TH0 cell clones. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:873-875.
  4. Moffat S, Higashimura N, Sugamura K. CD134 (OX40) Workshop Panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:869-871.
  5. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  6. Schwarting R, Stein H. ACT35: a new mAb recognizing a 35-kDa antigen with a tissue distribution similar to that of the CD25 molecule (interleukin-2 receptor). In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:464-465.
  7. Schwarting R, Stein H. Report on single/unclustered and provisionally grouped antibodies. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:460-463.
View All (7) View Less
940060 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.