Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD133

BD™ AbSeq Oligo Mouse Anti-Human CD133

Clone W6B3C1 (also known as W6B3) (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
PROM1; PROML1; prominin-1; AC133; CORD12; MCDR2; MSTP061; RP41; STGD4
8842
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTTGGTATTGGCACGGTTTGTAGCGAGTTGACGGTC
AHS0103
WERI-RB-1 Retinoblastoma Cell
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940095 Rev. 3
Antibody Details
Down Arrow Up Arrow
W6B3C1

The W6B3C1 monoclonal antibody specifically recognizes CD133 which is also known as Prominin-like protein 1 (PROML1), Prominin-1 (PROM1), hProminin, Hematopoietic stem cell antigen, Macular dystrophy retinal 2 (MCDR2), Stargardt disease 4 autosomal dominant (STGD4), or AC133 antigen. CD133 is an ~120 kDa five-transmembrane, glycoprotein that is encoded by PROM1 (Prominin 1) which belongs to the Prominin gene family. This single-chain, pentaspan transmembrane glycoprotein is comprised of an extracellular N-terminus with two short intracellular sequences and two long extracellular loops followed by an intracellular C-terminus. CD133 is expressed on some cells found in a variety of tissues including the bone marrow, cord and peripheral blood, placenta, liver, pancreas, kidney, lung, retina, brain and heart. It is expressed on various cell types including hematopoietic stem cells and progenitor cells, neural stem cells, developing epithelial cells, precursor endothelial cells, and retinal cells. CD133 is expressed on some cancer cells found in leukemias, melanoma and retinoblastoma. It may serve as a cancer stem cell marker in a number of brain tumors, melanoma, colon cancer, hepatocellular carcinoma, pancreatic adenocarcinoma, and prostate cancer. A mutation in PROM1 is reportedly associated with a form of human retinal degeneration. The W6B3C1 antibody recognizes a different epitope than the human CD133-specific 293C3 antibody.

940095 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940095 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940095" on CiteAb

Development References (5)

  1. Bühring HK, Marzer A, Lammers R, Wissinger B. CD133 cluster report. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:622-623.
  2. Koerner SP, André MC, Leibold JS, et al. An Fc-optimized CD133 antibody for induction of NK cell reactivity against myeloid leukemia.. Leukemia. 2017; 31(2):459-469. (Clone-specific: Blocking, Flow cytometry). View Reference
  3. Lammers R, Giesert C, Grünebach F, Marxer A, Vogel W, Bühring HJ. Monoclonal antibody 9C4 recognizes epithelial cellular adhesion molecule, a cell surface antigen expressed in early steps of erythropoiesis.. Exp Hematol. 2002; 30(6):537-45. (Immunogen: Flow cytometry). View Reference
  4. Maw MA, Corbeil D, Koch J, et al. A frameshift mutation in prominin (mouse)-like 1 causes human retinal degeneration.. Hum Mol Genet. 2000; 9(1):27-34. (Biology). View Reference
  5. Miraglia SJ, Buck D. CD133 (AC133). In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:870-872.
940095 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.