Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD124

BD™ AbSeq Oligo Mouse Anti-Human CD124

Clone hIL4R-M57 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
IL-4 Receptor α Chain, CD124
3566
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGCGATGTTAGAAGCGTTGTTACCCGGTGTTGACTG
AHS0098
Soluble Human IL-4 Receptor
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940092 Rev. 3
Antibody Details
Down Arrow Up Arrow
hIL4R-M57

The hIL4R-M57 antibody specifically binds to the α subunit (IL-4Rα) of the human Interleukin-4 Receptor complex which is also known as CD124. The human IL-4Rα, also known as B cell stimulatory factor 1 receptor (BSF-1 receptor), is a 140 kDa transmembrane glycoprotein that is expressed by B and T lymphocytes and a variety of other hematopoietic and non-hematopoietic cells and cell lines. The cell surface IL-4Rα chain binds IL-4 with high affinity and associates with either the common γ chain (IL-4Rα/γc; aka, type I IL-4R complex) or the IL-13 receptor alpha-1 subunit (IL-4Rα/IL-13Rα1; aka, type II IL-4R complex) to form two distinct types of signal-transducing IL-4R complexes. The type I IL-4 receptor complex specifically binds IL-4 whereas the type II IL-4R complex binds and transduces signals from either IL-4 or IL-13. A truncated form of the IL-4Rα exists in soluble form in biological fluids. In contrast to mice, in humans no distinct mRNA coding for sIL-4R has been described, suggested that human sIL4-R is exclusively produced by proteolytic cleavage of the cell surface receptor. The serum levels of soluble IL-4Rα appear to elevate in pathological situations such as allergy and parasitic infections. Depending on the ratios of IL-4 and sIL-4Rα present in the local milieu, the sIL-4Rα may augment or antagonize the activities of IL-4. The immunogen used to generate the hIL4R-M57 hybridoma was soluble human IL-4R.

940092 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940092 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940092" on CiteAb

Development References (6)

  1. Agrawal B, Krantz MJ, Parker J, Longenecker BM. Expression of MUC1 mucin on activated human T cells: implications for a role of MUC1 in normal immune regulation. Cancer Res. 1998; 58(18):4079-4081. (Biology: ELISA, Flow cytometry). View Reference
  2. Devine PL, Birrell GW, Whitehead RH, Harada H, Xing PX, McKenzie IF. Expression of MUC1 and MUC2 mucins by human tumor cell lines. Tumour Biol. 1992; 13(5):268-277. (Biology). View Reference
  3. McGuckin MA, MacDonald KP, Tran M, Wykes M, Hart DNJ. MUC1 Epithelial mucin: expression by normal hematopoietic cells. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:496-499.
  4. McGuckin MA. CD227 (MUC1) Summary and Workshop Report. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:494-496.
  5. Xing PX, Prenzoska J, McKenzie IF. Epitope mapping of anti-breast and anti-ovarian mucin monoclonal antibodies. Mol Immunol. 1992; 29(5):641-650. (Clone-specific: Blocking, ELISA). View Reference
  6. Xing PX, Prenzoska J, Quelch K, McKenzie IF. Second generation anti-MUC1 peptide monoclonal antibodies. Cancer Res. 1992; 52(8):2310-2317. (Immunogen: Blocking, Radioimmunoassay). View Reference
View All (6) View Less
940092 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.