Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD11c

BD™ AbSeq Oligo Mouse Anti-Human CD11c

Clone SHCL-3 (also known as S-HCL-3) (RUO)

940265
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
CR4; ITGAX; SLEB6; integrin alpha X
2 µl
Mouse IgG2b
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTCGGTTCGTGATTTAGTTAGTGCGTCTTAGTGTCC
AHS0183
Human Hairy-Cell Leukemia Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940265 Rev. 3
Antibody Details
Down Arrow
SHCL-3

The S-HCL-3 monoclonal antibody specifically binds to CD11c which is also known as Integrin alpha X (Integrin αX), Complement component 3 receptor 4 subunit or CR4. CD11c is a ~150 kDa type I transmembrane glycoprotein that is encoded by ITGAX (integrin subunit alpha X). CD11c (Integrin αX) is expressed on dendritic cells, monocytes, macrophages, granulocytes, NK cells and subsets of B and T cells. CD11c (Integrin αX) is also present on hairy cell leukemias (HCL) and on some acute myeloid leukemias (AML). The S-HCL-3 antibody stains sinus histiocytes of lymph node, tonsil, and spleen; macrophages in the cortex and medulla of thymus; Kupffer cells in liver; elongated intertubular cells in kidney; and alveolar macrophages in lung tissue. In malignant tissue, the antibody stains true histiocytic lymphomas; it does not stain carcinomas or T or B lymphomas. CD11c (Integrin αX) associates with CD18 (ITGB2/Integrin beta-2) to form the CD11c/ CD18 heterodimer which is likewise known as Leukocyte adhesion receptor p150,95 or Complement receptor type 4 (CR4). Ligands for this heterodimeric adhesion receptor include fibrinogen, iC3b, CD23, and CD54 (ICAM-1).

940265 Rev. 3
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940265 Rev.3
Citations & References
Down Arrow

Development References (2)

  1. Reinherz EL. Ellis L. Reinherz .. et al., ed. Leukocyte typing II. New York: Springer-Verlag; 1986:1-560.
  2. Rieber EP, Rank G, Kohler I, Krauss S. Membrane expression of Fc epsilon RII/CD23 and release of soluble CD23 by follicular dendritic cells. Adv Exp Med Biol. 1993; 329:393-398. (Clone-specific: Flow cytometry, Immunoprecipitation). View Reference
940265 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.