Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD103

BD™ AbSeq Oligo Mouse Anti-Human CD103

Clone Ber-ACT8 (RUO)

940067
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
ITGAE; Integrin alpha-E; ITAE; HML-1 antigen; Mucosal lymphocyte 1; HUMINAE
3682
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAATAGTATCGAGCGTAGTTAAGTTGCGTAGCCGTT
AHS0001
Human MAPS16 T Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940067 Rev. 3
Antibody Details
Down Arrow
Ber-ACT8

The Ber-ACT8 monoclonal antibody specifically binds to the human mucosal lymphocyte antigen 1 (HML-1). This is a 175 kDa type I transmembrane glycoprotein, also known as integrin αE (ITGAE, Integrin alpha-E) and CD103. It is found on >90% of intestinal intraepithelial lymphocytes (iIEL) associated with integrin β7. CD103 is also expressed on lamina propria T lymphocytes in the intestine and on phytohemagglutinin-stimulated peripheral blood lymphocytes. It is rarely expressed on resting peripheral blood lymphocytes. It has been suggested that CD103 may have an accessory function for activation of iIEL. CD103 has been reported as a useful tool in hairy cell leukemia research.

940067 Rev. 3
Citations & References
Down Arrow

Development References (7)

  1. DiGiuseppe JA, Borowitz MJ. Clinical utility of flow cytometry in the chronic lymphoid leukemias. Semin Immunol. 1998; 25(1):6-10. (Biology). View Reference
  2. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  3. Kruschwitz M, Fritzsche G, Schwarting R, et al. Ber-ACT8: new monoclonal antibody to the mucosa lymphocyte antigen. J Clin Pathol. 1991; 44(8):636-645. (Immunogen: Blocking, Flow cytometry, Immunoaffinity chromatography, Immunocytochemistry (cytospins), Immunohistochemistry, Immunoprecipitation). View Reference
  4. Matutes E, Meeus P, McLennan K, Catovsky D. The significance of minimal residual disease in hairy cell leukaemia treated with deoxycoformycin: a long-term follow-up study. Br J Haematol. 1997; 98(2):375-383. (Biology). View Reference
  5. Micklem KJ, Dong Y, Willis A, et al. HML-1 antigen on mucosa-associated T cells, activated cells, and hairy leukemic cells is a new integrin containing the beta 7 subunit. Am J Pathol. 1991; 139(6):1297-1301. (Clone-specific: Immunoprecipitation). View Reference
  6. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  7. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
View All (7) View Less
940067 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.