Skip to main content Skip to navigation
Oligo Mouse Anti-Human c-Met

BD™ AbSeq Oligo Mouse Anti-Human c-Met

Clone 3D6 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
MET; cMet; HGFR; HGF receptor; AUTS9; RCCP2; SF receptor
4233
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGCGTGAGTTGTCGGTAGTTAATTATCGGAGAGTTT
AHS0132
Human c-Met Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940222 Rev. 2
Antibody Details
Down Arrow Up Arrow
3D6

The 3D6 monoclonal antibody specifically binds to c-Met (MET), which is also known as Hepatocyte growth factor receptor (HGFR) or Scatter factor receptor (SF receptor). c-Met is a 190 kDa single-pass type I transmembrane glycoprotein that is posttranslationally cleaved into a disulfide-linked extracellular α-chain and a transmembrane β-chain. c-Met functions as a receptor tyrosine kinase (RTK) that is normally involved in the development, regeneration, and survival of cells and tissues. c-Met is expressed on a variety of cell types including stem cells and progenitor cells, hepatocytes, keratinocytes, epithelial cells, endothelial cells, and neurons. c-Met is autophosphorylated when bound by its ligand, Hepatocyte Growth Factor (HGF). This leads to further activation of downstream signaling pathways that induce multiple responses including cellular migration, proliferation, survival, and angiogenesis. Abnormal c-Met expression or activity has been associated with tumorigenesis. The 3D6 antibody can reportedly function as an agonist by binding to and activating human but not mouse c-Met.

940222 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940222 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940222" on CiteAb

Development References (5)

  1. Kong-Beltran M, Seshagiri S, Zha J, et al. Somatic mutations lead to an oncogenic deletion of met in lung cancer.. Cancer Res. 2006; 66(1):283-9. (Clone-specific: Activation, Bioassay, Functional assay, In vivo exacerbation, Stimulation). View Reference
  2. Nguyen TH, Loux N, Dagher I, et al. Improved gene transfer selectivity to hepatocarcinoma cells by retrovirus vector displaying single-chain variable fragment antibody against c-Met.. Cancer Gene Ther. 2003; 10(11):840-9. (Clone-specific: Bioassay, Flow cytometry, Functional assay). View Reference
  3. Ohashi K, Marion PL, Nakai H, et al. Sustained survival of human hepatocytes in mice: A model for in vivo infection with human hepatitis B and hepatitis delta viruses.. Nat Med. 2000; 6(3):327-31. (Immunogen: Activation, Functional assay, In vivo exacerbation, Stimulation). View Reference
  4. Sakai K, Aoki S, Matsumoto K. Hepatocyte growth factor and Met in drug discovery.. J Biochem. 2015; 157(5):271-84. (Biology). View Reference
  5. Wright TG, Singh VK, Li JJ, et al. Increased production and secretion of HGF alpha-chain and an antagonistic HGF fragment in a human breast cancer progression model.. Int J Cancer. 2009; 125(5):1004-15. (Clone-specific: ELISA). View Reference
940222 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.