Oligo Mouse Anti-Human CD19
Clone SJ25C1 (also known as SJ25-C1) (RUO)
- Brand BD™ AbSeq
- Alternative Name B4; B-lymphocyte antigen CD19; Leu-12
- Entrez Gene ID 930
- Vol. Per Test 2 µl
- Isotype Mouse BALB/c IgG1, κ
- Reactivity Human (Tested in Development)
- Application
Single Cell 3' Sequencing (Qualified)
- Barcode Sequence TAGTAATGTGTTCGTAGCCGGTAATAATCTTCGTGG
- Sequence ID AHS0030
- Immunogen Human NALM1 + NALM16 cells
- Storage Buffer Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
- Regulatory Status RUO
Regulatory Status Legend
Description
The SJ25C1 monoclonal antibody specifically binds to CD19, a B lymphocyte-lineage differentiation antigen. CD19, a 90-kDa transmembrance glycoprotein, is a member of the immunoglobulin superfamily and is expressed throughout B-lymphocyte development from the pro-B cell through the mature B-cell stages. Terminally differentiated plasma cells do not express CD19. On the surface of mature B cells, the CD19 molecule associates with CD21 (CR-2) and CD81 (TAPA-1), and this multimolecular complex synergizes with surface immunoglobulin to promote cellular activation. Studies with CD19-deficient mice have suggested that the level of CD19 expression affects the generation and maturation of B cells in the bone marrow and periphery. B-1 lineage B cells, also known as CD5+ B cells, are drastically reduced or absent in CD19-deficient mice. Increased levels of CD19 expression correlate with increased frequencies of peritonal and splenic B-1 cells and reduced numbers of conventional B lymphocytes in the periphery. CD19 participates in B-lymphocyte development, B-cell activation, maturation of memory B cells and regulation of tolerance. CD19 has also been detected on peritoneal mast cells, co-localized with CD21/CD35, and it is proposed to play a role in complement-mediated mast-cell activation.
Application Notes
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system or other oligo-dT-based capture systems. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.
Format
- Format Antibody-Oligo
Suggested Companion Products
Stain Buffer (FBS) RUO
500 mL
Cat No: 554656
Human BD Fc Block™ RUO
0.25 mg
Cat No: 564220
Human BD Fc Block™ RUO
50 mg
Cat No: 564219
Single-Cell Analysis System RUO
1 Each
Cat No: 633701
Resources & Tools | ||||||
---|---|---|---|---|---|---|
Spectrum Viewer | Regulatory Document Website | Download TDS |
Preparation and Storage
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze.
The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.
Product Notices
- This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
- The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
- Please refer to bd.com/genomics-resources for technical protocols.
- Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
- Source of all serum proteins is from USDA inspected abattoirs located in the United States.
- This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
- Illumina is a trademark of Illumina, Inc.
Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.
BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.