Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse FcγRIV (CD16-2)

Oligo Hamster Anti-Mouse FcγRIV (CD16-2)

Clone 9E9

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD16-2; Fcgr4; FcgRIV; Fc gammaRIV; FcgammaRIV; Fcgr3a; Fcrl3
246256
2 µl
Armenian Hamster IgG
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GCACGGCATAGGTTGAATTGGTTGACGATCTGTAGG
AMM2126
Mouse FcγRIV Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
  9. Please refer to bd.com/genomics-resources for technical protocols.
940338 Rev. 1
Antibody Details
Down Arrow Up Arrow
9E9

The 9E9 monoclonal antibody specifically binds to Fc receptor, IgG, low affinity IV (FcγRIV), which is also known as CD16-2. FcγRIV is encoded by Fcgr4 and belongs to the family of receptors for the Fc region of IgG (FcγRs), which also includes FcγRI (CD64), FcγRII (CD32), and FcγRIII (CD16) within the Ig superfamily. FcγRIV is expressed on monocytes, macrophages, dendritic cells, and neutrophils. FcγRIV, which serves as a ligand-biding subunit, requires the common Fcγ chain for expression and signaling. This complex serves as a cell activating receptor when bound by IgG2a or IgG2b. FcγRIV plays various roles in inflammation including neutrophil trafficking and mast cell degranulation. FcγRIV can also function as a low-affinity IgE receptor and promote IgE-induced inflammation. The 9E9 antibody can reportedly inhibit cellular FcγRIV (CD16-2) function and block non-antigen-specific binding of immune complexes to improve the quality of immunological assays.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE:  The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

940338 Rev. 1
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms. NOTE: The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.
Antibody-Oligo
940338 Rev.1
Citations & References
Down Arrow Up Arrow

Development References (5)

  1. Bruhns P. Properties of mouse and human IgG receptors and their contribution to disease model. Blood. 2012; 119(24):5640-5649. (Biology). View Reference
  2. Mancardi DA, Iannascoli B, Hoos S, England P, Daëron M, Bruhns P. FcgammaRIV is a mouse IgE receptor that resembles macrophage FcepsilonRI in humans and promotes IgE-induced lung inflammation. J Clin Invest. 2008; 118(11):3738-3750. (Clone-specific). View Reference
  3. Nimmerjahn F, Lux A, Albert H, et al. FcγRIV deletion reveals its central role for IgG2a and IgG2b activity in vivo. Proc Natl Acad Sci U S A. 2010; 107(45):19396-19401. (Clone-specific). View Reference
  4. Nimmerjahn F, Ravetch JV. FcγRs in health and disease. Curr Top Microbiol Immunol. 2011; 350:105-125. (Biology). View Reference
  5. Syed SN, Konrad S, Wiege K, et al. Both FcgammaRIV and FcgammaRIII are essential receptors mediating type II and type III autoimmune responses via FcRgamma-LAT-dependent generation of C5a. Eur J Immunol. 2009; 39(12):3343-3356. (Clone-specific). View Reference
940338 Rev. 1

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.