Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD9

Oligo Rat Anti-Mouse CD9

Clone KMC8 (also known as KMC 8)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Cd9; Tetraspanin-29; Tspan29
12527
2 µl
Rat LOU, also known as Louvain, LOU/C, LOU/M IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTAGGGTATCCGGAGAAGCGTAAAGTATGACATGGG
AMM2096
(C57BL/6 x DBA/2)F1 mouse bone marrow-derived stromal cell line BMS2
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Illumina is a trademark of Illumina, Inc.
  8. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
940200 Rev. 1
Antibody Details
Down Arrow Up Arrow
KMC8

The KMC8 monoclonal antibody specifically binds to CD9 which is also known as Tetraspanin-29 (Tspan29). CD9 is a 24-kDa member of the transmembrane 4 superfamily, also called the tretraspanin family. In the mouse, CD9 is present on bone marrow myeloid cells, stromal cells, and megakaryocyte-committed progenitors; subsets of peripheral T and B lymphocytes; and neutrophils, platelets, dendritic cells, and bone marrow-derived macrophages. CD9 has been found to be associated with integrins and other cell-surface receptors. It appears to play roles in signal transduction and in regulating cellular adhesive properties. CD9 can also reportedly participate in T-cell costimulation and induction of apoptosis. The KMC8 antibody reportedly blocks certain CD9 functions and activates macrophages.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE:  The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

940200 Rev. 1
Format Details
Down Arrow Up Arrow
Antibody-Oligo
Antibody-Oligo
940200 Rev.1
Citations & References
Down Arrow Up Arrow

Development References (9)

  1. Jennings LK, Crossno JT Jr, Fox CF, White MM, Green CA. Platelet p24/CD9, a member of the tetraspanin family of proteins. Ann N Y Acad Sci. 1994; 714:175-184. (Biology). View Reference
  2. Kaji K, Takeshita S, Miyake K, Takai T, Kudo A. Functional association of CD9 with the Fc gamma receptors in macrophages. J Immunol. 2001; 166(5):3256-3265. (Clone-specific: Activation). View Reference
  3. Miyake K, Medina KL, Hayashi S, Ono S, Hamaoka T, Kincade PW. Monoclonal antibodies to Pgp-1/CD44 block lympho-hemopoiesis in long-term bone marrow cultures. J Exp Med. 1990; 171(2):477-488. (Immunogen: ELISA). View Reference
  4. Nakorn TN, Miyamoto T, Weissman IL. Characterization of mouse clonogenic megakaryocyte progenitors. Proc Natl Acad Sci U S A. 2003; 100(1):205-210. (Biology). View Reference
  5. Oritani K, Wu X, Medina K, et al. Antibody ligation of CD9 modifies production of myeloid cells in long-term cultures. Blood. 1996; 87(6):2252-2261. (Immunogen: Blocking). View Reference
  6. Park CS, Yashiro Y, Tai XG, et al. Differential involvement of a Fas-CPP32-like protease pathway in apoptosis of TCR/CD9-costimulated, naive T cells and TCR-restimulated, activated T cells.. J Immunol. 1998; 160(12):5790-6. (Clone-specific: Apoptosis, (Co)-stimulation). View Reference
  7. Pulendran B, Lingappa J, Kennedy MK, et al. Developmental pathways of dendritic cells in vivo: distinct function, phenotype, and localization of dendritic cell subsets in FLT3 ligand-treated mice. J Immunol. 1997; 159(5):2222-2231. (Biology). View Reference
  8. Tanio Y, Yamazaki H, Kunisada T, Miyake K, Hayashi SI. CD9 molecule expressed on stromal cells is involved in osteoclastogenesis. Exp Hematol. 1999; 27(5):853-859. (Clone-specific: Blocking). View Reference
  9. Wright MD, Tomlinson MG. The ins and outs of the transmembrane 4 superfamily. Immunol Today. 1994; 15(12):588-594. (Biology). View Reference
View All (9) View Less
940200 Rev. 1

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

Non-IVD products are For Research Use Only. Not for use in diagnostic or therapeutic procedures.

 

23-22940-00