Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD83

BD™ AbSeq Oligo Rat Anti-Mouse CD83

Clone Michel-19 (RUO)

940350
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Cd83; CD83 antigen
12522
2 µl
Rat IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GAGGTAGTTTAGAGCCGTTAGATGGATAGTCAGGTG
AMM2151
Mouse CD83 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940350 Rev. 2
Antibody Details
Down Arrow
Michel-19

The Michel-19 antibody reacts with CD83, a member of the immunoglobulin superfamily that is expressed on mature dendritic cells and activated T lymphocytes.  Furthermore, thymic cortical epithelial cells express Cd83 transcripts.  CD83 is involved in the regulation of T-cell development and immune responses, and its ligand is found on a subpopulation of splenic B lymphocytes.

940350 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940350 Rev.2
Citations & References
Down Arrow

Development References (8)

  1. Berchtold S, Muhl-Zurbes P, Heufler C, Winklehner P, Schuler G, Steinkasserer A. Cloning, recombinant expression and biochemical characterization of the murine CD83 molecule which is specifically upregulated during dendritic cell maturation. FEBS Lett. 1999; 461:211-216. (Biology). View Reference
  2. Cramer SO, Trumpfheller C, Mehlhoop U, More S, Fleischer B, von Bonin A. Activation-induced expression of murine CD83 on T cells and identification of a specific CD83 ligand on murine B cells. Int Immunol. 2000; 12(9):1347-1351. (Biology). View Reference
  3. Fujimoto Y, Tu L, Miller AS, et al. CD83 expression influences CD4+ T cell development in the thymus. Cell. 2002; 108:755-767. (Biology). View Reference
  4. Kretschmer B, Kuhl S, Fleischer B, Breloer M. Activated T cells induce rapid CD83 expression on B cells by engagement of CD40. Immunol Lett. 2011; 136(2):221-227. (Clone-specific: Flow cytometry). View Reference
  5. Kretschmer B, Luthje K, Ehrlich S, et al. CD83 on murine APC does not function as a costimulatory receptor for T cells. Immunol Lett. 2008; 120(1-2):87-95. (Immunogen: Flow cytometry). View Reference
  6. Luthje K, Kretschmer B, Fleischer B, Breloer M. CD83 regulates splenic B cell maturation and peripheral B cell homeostasis. Int Immunol. 2008; 20(8):949-960. (Clone-specific: Flow cytometry). View Reference
  7. Wolenski M, Cramer SO, Ehrlich S, Steeg C, Fleischer B, von Bonin A. Enhanced activation of CD83-positive T cells. Scand J Immunol. 2003; 58(3):306-311. (Biology). View Reference
  8. Wolenski M, Cramer SO, Ehrlich S, et al. Expression of CD83 in the murine immune system. Med Microbiol Immunol (Berl). 2003; 192(4):189-192. (Biology). View Reference
View All (8) View Less
940350 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.