Skip to main content Skip to navigation
Hamburger Menu
Search icon
Country Selector Country Selector
Middle East / Africa (English)
Products

Solutions

Discover & Learn

Resources & Tools

Support

Search icon Search icon
Close Menu
    Alert Icon
    Oligo Rat Anti-Mouse CD62L

    BD™ AbSeq Oligo Rat Anti-Mouse CD62L

    Clone MEL-14

    (RUO)
    Product Details
    Down Arrow Up Arrow


    BD™ AbSeq
    Sell; L-selectin; LECAM-1; LAM-1; Lnhr; Ly-22; Ly-m22; Lyam-1
    20343
    2 µl
    Rat F344, also known as Fischer, CDF IgG2a, κ
    Mouse (Tested in Development)
    Single Cell 3' Sequencing (Qualified)
    TAGGAGAGATTCGTGGTAGATTTAGCGTAGGTCATT
    AMM2018
    C3H/eb mouse B lymphoma 38C-13
    Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
    RUO
    Rat


    Preparation And Storage

    Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
    Show More blue down arrow Show Less blue up arrow

    Recommended Assay Procedures

    Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

    BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

    Show More blue down arrow Show Less blue up arrow

    Product Notices

    1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
    2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
    3. Please refer to bd.com/genomics-resources for technical protocols.
    4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
    5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
    6. Illumina is a trademark of Illumina, Inc.
    7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
    8. For U.S. patents that may apply, see bd.com/patents.
    Show More blue down arrow Show Less blue up arrow
    940122 Rev. 2
    Antibody Details
    Down Arrow Up Arrow
    MEL-14

    The MEL-14 monoclonal antibody specifically binds to CD62L (L-selectin), a 95 kDa (on neutrophils) or 74 kDa (on lymphocytes) receptor with lectin-like and Epidermal Growth Factor-like domains. In the mouse, L-selectin is detected on most thymocytes, with the highest levels of expression on an immunocompetent subset and a population of dividing progenitor cells, and on peripheral leukocytes, including subsets of B and T lymphocytes, neutrophils, monocytes, and eosinophils. This member of the selectin adhesion molecule family appears to be required for lymphocyte homing to peripheral lymph nodes and to contribute to neutrophil emigration at inflammatory sites. L-selectin is rapidly shed from lymphocytes and neutrophils upon cellular activation; metalloproteinases may mediate the release of CD62L ectodomains from the cell surface. The level of CD62L expression, along with other markers, distinguishes naive, effector, and memory T cells. L-selectin binds to sialytaed oligosaccharide determinants on high endothelial venules (HEV) in peripheral lymph nodes. In vitro studies have demonstrated that CD34, GlyCAM-1, and MAdCAM-1, all recognized by mAb MECA-79 (anti-mouse PNAd Carbohydrate Epitope, Cat. No. 553863), may be ligands for CD62L. MEL-14 mAb blocks in vitro binding of lymphocytes to peripheral lymph node HEV and inhibits in vivo lymphocyte extravasation into peripheral lymph nodes and late stages of leukocyte rolling.

    940122 Rev. 2
    Format Details
    Down Arrow Up Arrow
    Antibody-Oligo
    The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
    Antibody-Oligo
    940122 Rev.2
    Citations & References
    Down Arrow Up Arrow

    Development References (15)

    1. Ernst DN, Weigle WO, Noonan DJ, McQuitty DN, Hobbs MV. The age-associated increase in IFN-γ synthesis by mouse CD8+ T cells correlates with shifts in the frequencies of cell subsets defined by membrane CD44, CD45RB, 3G11, and MEL-14 expression. J Immunol. 1993; 151(2):575-587. (Clone-specific: Flow cytometry). View Reference
    2. Gallatin WM, Weissman IL, Butcher EC. A cell-surface molecule involved in organ-specific homing of lymphocytes. Nature. 1983; 304(5921):30-34. (Immunogen: Blocking, Flow cytometry, Immunoaffinity chromatography, Immunoprecipitation). View Reference
    3. Iwabuchi K, Ohgama J, Ogasawara K, et al. Distribution of MEL-14+ cells in various lymphoid tissues. Immunobiology. 1991; 182(2):161-173. (Clone-specific: Cytotoxicity). View Reference
    4. Jung TM, Gallatin WM, Weissman IL, Dailey MO. Down-regulation of homing receptors after T cell activation. J Immunol. 1988; 141(12):4110-4117. (Clone-specific: Flow cytometry). View Reference
    5. Kishimoto TK, Jutila MA, Berg EL, Butcher EC. Neutrophil Mac-1 and MEL-14 adhesion proteins inversely regulated by chemotactic factors. Science. 1989; 245(4923):1238-1241. (Clone-specific: Immunohistochemistry). View Reference
    6. Lewinsohn DM, Bargatze RF, Butcher EC. Leukocyte-endothelial cell recognition: evidence of a common molecular mechanism shared by neutrophils, lymphocytes, and other leukocytes. J Immunol. 1987; 138(12):4313-4321. (Clone-specific: Blocking, Immunoprecipitation). View Reference
    7. Ley K, Bullard DC, Arbones ML, et al. Sequential contribution of L- and P-selectin to leukocyte rolling in vivo. J Exp Med. 1995; 181(2):669-675. (Clone-specific: Blocking). View Reference
    8. Mobley JL, Dailey MO. Regulation of adhesion molecule expression by CD8 T cells in vivo. I. Differential regulation of gp90MEL-14 (LECAM-1), Pgp-1, LFA-1, and VLA-4 alpha during the differentiation of cytotoxic T lymphocytes induced by allografts. J Immunol. 1992; 148(8):2348-2356. (Clone-specific: Flow cytometry). View Reference
    9. Pizcueta P, Luscinskas FW. Monoclonal antibody blockade of L-selectin inhibits mononuclear leukocyte recruitment to inflammatory sites in vivo. Am J Pathol. 1994; 145(2):461-469. (Clone-specific: Flow cytometry, Immunohistochemistry). View Reference
    10. Reichert RA, Jerabek L, Gallatin WM, Butcher EC, Weissman IL. Ontogeny of lymphocyte homing receptor expression in the mouse thymus. J Immunol. 1986; 136(10):3535-3542. (Clone-specific: Flow cytometry, Immunohistochemistry). View Reference
    11. Reichert RA, Weissman IL, Butcher EC. Dual immunofluorescence studies of cortisone-induced thymic involution: evidence for a major cortical component to cortisone-resistant thymocytes. J Immunol. 1986; 136(10):3529-3534. (Clone-specific: Flow cytometry). View Reference
    12. Reichert RA, Weissman IL, Butcher EC. Phenotypic analysis of thymocytes that express homing receptors for peripheral lymph nodes. J Immunol. 1986; 136(10):3521-3528. (Clone-specific: Flow cytometry). View Reference
    13. Siegelman MH, Cheng IC, Weissman IL, Wakeland EK. The mouse lymph node homing receptor is identical with the lymphocyte cell surface marker Ly-22: role of the EGF domain in endothelial binding. Cell. 1990; 61(4):611-622. (Clone-specific: Blocking, Immunoprecipitation). View Reference
    14. Vestweber D. Ligand-specificity of the selectins. J Cell Biochem. 1996; 61(4):585-591. (Biology). View Reference
    15. Yang G, Mizuno MT, Hellstrom KE, Chen L. B7-negative versus B7-positive P815 tumor: differential requirements for priming of an antitumor immune response in lymph nodes. J Immunol. 1997; 158(2):851-858. (Clone-specific: Blocking). View Reference
    View All (15) View Less
    940122 Rev. 2

    Please refer to Support Documents for Quality Certificates


    Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


    Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

    For Research Use Only. Not for use in diagnostic or therapeutic procedures.

    Website Feedback