Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD45RA

BD™ AbSeq Oligo Rat Anti-Mouse CD45RA

Clone 14.8

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Ptprc; CD45R; CD45; LCA; Leukocyte common antigen; Ly-5; Lyt-4
19264
2 µl
Rat IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAGGAGGAGGTCGTGAGTAGATTATGAGTCGTATTC
AMM2119
Radiation-induced NZC mouse B lymphoma WEHI-279
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940335 Rev. 2
Antibody Details
Down Arrow Up Arrow
14.8

The 14.8 monoclonal antibody specifically recognizes an exon A-dependent epitope of the CD45 protein, which is found at high density on B cells and at low density on peripheral T cytotoxic/suppressor cells and a very small subset of thymocytes. Nearly all B-lineage cells, including B-cell precursors in fetal liver and adult bone marrow and Ig-secreting cells, but not hematopoietic stem cells or myeloid progenitors, have been reported to be detectable by mAb 14.8. CD45 is a member of the Protein Tyrosine Phosphatase (PTP) family: Its intracellular (COOH-terminal) region contains two PTP catalytic domains, and the extracellular region is highly variable due to alternative splicing of exons 4, 5, and 6 (designated A, B, and C, respectively), plus, differing levels of glycosylation. The CD45 isoforms detected in the mouse are cell type-, maturation-, and activation state-specific. The CD45 isoforms play complex roles in T-cell and B-cell antigen receptor signal transduction. mAb 14.8 has been reported to enhance the proliferative effect of PHA on purified spleen T cells, possibly by replacing a signal normally delivered by accessory cells, to enhance isotype switching during in vitro B-cell responses, and to inhibit antigen-induced p21 [ras] activation.

940335 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940335 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (10)

  1. George A, Rath S, Shroff KE, Wang M, Durdik JM. Ligation of CD45 on B cells can facilitate production of secondary Ig isotypes. J Immunol. 1994; 152(3):1014-1021. (Clone-specific: Functional assay, Stimulation). View Reference
  2. Goff LK, Huby RD. Characterization of constitutive and strain-dependent subsets of CD45RA+ cells in the thymus. Int Immunol. 1992; 4(11):1303-1311. (Biology). View Reference
  3. Hathcock KS, Laszlo G, Dickler HB, et al. Expression of variable exon A-, B-, and C-specific CD45 determinants on peripheral and thymic T cell populations. J Immunol. 1992; 148(1):19-28. (Clone-specific: Flow cytometry). View Reference
  4. Inoue T, Asano Y, Matsuoka S, et al. Distinction of mouse CD8+ suppressor effector T cell clones from cytotoxic T cell clones by cytokine production and CD45 isoforms. J Immunol. 1993; 150(6):2121-2128. (Clone-specific: Flow cytometry). View Reference
  5. Johnson P, Maiti A, Ng DHW. CD45: A family of leukocyte-specific cell surface glycoproteins. In: Herzenberg LA, Weir DM, Herzenberg LA, Blackwell C , ed. Weir's Handbook of Experimental Immunology, Vol 2. Cambridge: Blackwell Science; 1997:62.1-62.16.
  6. Kawauchi K, Lazarus AH, Rapoport MJ, Harwood A, Cambier JC, Delovitch TL. Tyrosine kinase and CD45 tyrosine phosphatase activity mediate p21ras activation in B cells stimulated through the antigen receptor. J Immunol. 1994; 152(7):3306-3316. (Clone-specific: Blocking, Functional assay, Immunoprecipitation). View Reference
  7. Kincade PW, Lee G, Watanabe T, Sun L, Scheid MP. Antigens displayed on murine B lymphocyte precursors. J Immunol. 1981; 127(6):2262-2268. (Clone-specific: Depletion, Flow cytometry). View Reference
  8. Kincade PW. Formation of B lymphocytes in fetal and adult life. Adv Immunol. 1981; 31:177-245. (Immunogen). View Reference
  9. Marvel J, Poirier G, Lightstone E. Anti-CD45RA antibodies increase the proliferation of mouse T cells to phytohemagglutinin through the interleukin 2/interleukin 2 receptor pathway. Eur J Immunol. 1989; 19(11):2005-2010. (Biology). View Reference
  10. Rogers PR, Pilapil S, Hayakawa K, Romain PL, Parker DC. CD45 alternative exon expression in murine and human CD4+ T cell subsets. J Immunol. 1992; 148(12):4054-4065. (Clone-specific: Flow cytometry). View Reference
View All (10) View Less
940335 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.