Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD223

BD™ AbSeq Oligo Rat Anti-Mouse CD223

Clone C9B7W (RUO)

940152
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Lag3; LAG-3; Lymphocyte-activation gene 3; Ly66
2 µl
Rat LEW, also known as Lewis IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CTGTTAGTGAGGTATGAGACGTCGAGTTAGTGAATT
AMM2048
Mouse LAG3 fusion protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940152 Rev. 2
Antibody Details
Down Arrow
C9B7W

The C9B7W antibody monoclonal antibody specifically binds to an epitope in the D2 domain of CD223 (LAG3), the 70-kDa protein encoded by Lymphocyte-activation gene 3 (Lag3). A fusion protein consisting of the entire extracellular region of mouse LAG3 with mouse IgG1 was used as immunogen. CD223 is a type-I membrane protein with four extracellular Ig-like domains; it is structurally homologous to CD4; and, like CD4, it binds MHC class II molecules. However, unlike CD4, it is not expressed on resting human and mouse T lymphocytes. In the mouse, as previously described in the human, CD223 expression is upregulated on T lymphocytes (both CD4+ and CD8+) activated through the T-cell receptor (TCR) and on IL-2-activated NK (LAK) cells, and it is not detected on B cells, dendritic cells, or Phorbol 12-myristate 13-acetate (PMA)-stimulated splenocytes. Studies on human peripheral T lymphocytes suggest that CD223 associates with the TCR to downregulate TCR signaling. In contrast, in vivo and in vitro evaluations of vaccination protocols in mice suggest that CD223 promotes immune responses by activating antigen-presenting cells. Furthermore, NK cells of Lag3-/- mice display defects in their capacity to kill certain tumor cells. Mouse CD223 also has been demonstrated to contribute to the suppressor function of T regulatory cells and the C9B7W antibody has been shown to inhibit this function in vitro and in vivo. Therefore, CD223 appears to play complex roles in the regulation of immune responses. Although the C9B7W antibody is unable to block the binding of MHC class II-IgG2a fusion protein to CD223, it is able to block the CD223-mediated inhibition of IL-2 production by a T-cell hybridoma responding to antigen.

940152 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940152 Rev.2
Citations & References
Down Arrow

Development References (9)

  1. Baixeras E, Huard B, Miossec C, et al. Characterization of the lymphocyte activation gene 3-encoded protein. A new ligand for human leukocyte antigen class II antigens. J Exp Med. 1992; 176(2):327-337. (Biology). View Reference
  2. El Mir S, Triebel F. A soluble lymphocyte activation gene-3 molecule used as a vaccine adjuvant elicits greater humoral and cellular immune responses to both particulate and soluble antigens. J Immunol. 2000; 164(11):5583-5589. (Biology). View Reference
  3. Hannier S, Tournier M, Bismuth G, Triebel F. CD3/TCR complex-associated lymphocyte activation gene-3 molecules inhibit CD3/TCR signaling. J Immunol. 1998; 161(8):4058-4065. (Biology). View Reference
  4. Hannier S, Triebel F. The MHC class II ligand lymphocyte activation gene-3 is co-distributed with CD8 and CD3-TCR molecules after their engagement by mAb or peptide-MHC class I complexes. Int Immunol. 1999; 11(11):1745-1752. (Biology). View Reference
  5. Huang CT, Workman CJ, Flies D, et al. Role of LAG-3 in regulatory T cells. Immunity. 2004; 21(4):503-513. (Clone-specific: Flow cytometry, Functional assay, Inhibition, In vivo exacerbation). View Reference
  6. Huard B, Mastrangeli R, Prigent P, et al. Characterization of the major histocompatibility complex class II binding site on LAG-3 protein. Proc Natl Acad Sci U S A. 1997; 94(11):5744-5749. (Biology). View Reference
  7. Miyazaki T, Dierich A, Benoist C, Mathis D. Independent modes of natural killing distinguished in mice lacking Lag3. Science. 1996; 272(5260):405-408. (Biology). View Reference
  8. Prigent P, El Mir S, Dréano M, Triebel F. Lymphocyte activation gene-3 induces tumor regression and antitumor immune responses. Eur J Immunol. 1999; 29(12):3867-3876. (Biology). View Reference
  9. Workman CJ, Rice DS, Dugger KJ, Kurschner C, Vignali DA. Phenotypic analysis of the murine CD4-related glycoprotein, CD223 (LAG-3). Eur J Immunol. 2002; 32(8):2255-2263. (Immunogen: Flow cytometry, Functional assay, Inhibition). View Reference
View All (9) View Less
940152 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.