Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD21/CD35

Oligo Rat Anti-Mouse CD21/CD35

Clone 7G6

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CR2/CR1
12902
2 µl
Rat SD, also known as Sprague-Dawley (outbred) IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAAGGGTCGCTAGTTACGTTGAGGTGAGAATATGTC
AMM2052
Purified Mouse CR1
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Illumina is a trademark of Illumina, Inc.
  8. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
940156 Rev. 1
Antibody Details
Down Arrow Up Arrow
7G6

The 7G6 antibody recognizes an epitope shared by 145-150-kDa and 190-kDa complement receptor proteins, originally designated CR2 (CD21) and CR1 (CD35), respectively.  In the mouse, CD21 and CD35 are expressed on the majority of peripheral B lymphocytes, on the majority of resident peritoneal macrophages and mast cells, on peripheral blood granulocytes after treatment with N-formyl-Met-Leu-Phe, and on follicular dendritic cells, but not on thymocytes, T cells, erythrocytes, or platelets.  CD21 is a ligand-binding component of the CD19/CD21/CD81 signal-transduction complex associated with the antigen receptor on B lymphocytes.  CD21/CD35 also co-localizes with CD19 on the surface of peritoneal mast cells.   Cr2null mice display impaired inflammatory and humoral immune responses in vivo.  The 7G6 mAb has been reported to inhibit rosette formation by C3d-bearing sheep erythrocytes, to block the complement dependent trapping of immune complexes by follicular dendritic cells, and to down-regulate mouse CD21/CD35 expression upon in vivo application, thus inhibiting primary antibody responses to immunization.  Co-stimulation of B-cell differentiation via Sepharose-coupled 7G6 antibody has also been observed.  The 7G6 mAb recognizes an epitope on CD35 distinct from the epitope recognized by anti-mouse CD35, clone 8C12, and it does not block binding of 8C12 mAb to mouse CD35.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE:  The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

940156 Rev. 1
Format Details
Down Arrow Up Arrow
Antibody-Oligo
Antibody-Oligo
940156 Rev.1
Citations & References
Down Arrow Up Arrow

Development References (15)

  1. Axcrona K, Gray D, Leanderson T. Regulation of B cell growth and differentiation via CD21 and CD40. Eur J Immunol. 1996; 26(9):2203-2207. (Clone-specific: (Co)-stimulation, Flow cytometry). View Reference
  2. Cariappa A, Tang M, Parng C, et al. The follicular versus marginal zone B lymphocyte cell fate decision is regulated by Aiolos, Btk, and CD21. Immunity. 2001; 14(5):603-615. (Clone-specific: Flow cytometry). View Reference
  3. Fagarasan S, Muramatsu M, Suzuki K, Nagaoka H, Hiai H, Honjo T. Critical roles of activation-induced cytidine deaminase in the homeostasis of gut flora. Science. 2002; 298(5597):1424-1427. (Clone-specific: Fluorescence microscopy, Immunofluorescence). View Reference
  4. Fischer MB, Goerg S, Shen L, et al. Dependence of germinal center B cells on expression of CD21/CD35 for survival. Science. 1998; 280(5363):582-585. (Biology). View Reference
  5. Gommerman JL, Oh DY, Zhou X, et al. A role for CD21/CD35 and CD19 in responses to acute septic peritonitis: a potential mechanism for mast cell activation. J Immunol. 2000; 165(12):6915-6921. (Clone-specific: Flow cytometry, Fluorescence microscopy, Immunofluorescence). View Reference
  6. Heyman B, Wiersma EJ, Kinoshita T. In vivo inhibition of the antibody response by a complement receptor-specific monoclonal antibody. J Exp Med. 1990; 172(2):665-668. (Clone-specific: Inhibition, In vivo exacerbation). View Reference
  7. Hu H, Martin BK, Weis JJ, Weis JH. Expression of the murine CD21 gene is regulated by promoter and intronic sequences. J Immunol. 1997; 158(10):4758-4768. (Biology). View Reference
  8. Kinoshita T, Takeda J, Hong K, Kozono H, Sakai H, Inoue K. Monoclonal antibodies to mouse complement receptor type 1 (CR1). Their use in a distribution study showing that mouse erythrocytes and platelets are CR1-negative. J Immunol. 1988; 140(9):3066-3072. (Immunogen: Immunoprecipitation, Radioimmunoassay). View Reference
  9. Kinoshita T, Thyphronitis G, Tsokos GC, et al. Characterization of murine complement receptor type 2 and its immunological cross-reactivity with type 1 receptor. Int Immunol. 1990; 2(7):651-659. (Clone-specific). View Reference
  10. Molina H, Holers VM, Li B, et al. Markedly impaired humoral immune response in mice deficient in complement receptors 1 and 2. Proc Natl Acad Sci U S A. 1996; 93(8):3357-3361. (Clone-specific: Flow cytometry). View Reference
  11. Oliver AM, Martin F, Gartland GL, Carter RH, Kearney JF. Marginal zone B cells exhibit unique activation, proliferative and immunoglobulin secretory responses. Eur J Immunol. 1997; 27(9):2366-2374. (Clone-specific: Flow cytometry). View Reference
  12. Oliver AM, Martin F, Kearney JF. IgMhighCD21high lymphocytes enriched in the splenic marginal zone generate effector cells more rapidly than the bulk of follicular B cells. J Immunol. 1999; 162(12):7198-7207. (Clone-specific: Flow cytometry). View Reference
  13. Thyphronitis G, Kinoshita T, Inoue K, et al. Modulation of mouse complement receptors 1 and 2 suppresses antibody responses in vivo. J Immunol. 1991; 147(1):224-230. (Clone-specific: Inhibition, In vivo exacerbation). View Reference
  14. Wiersma EJ, Kinoshita T, Heyman B. Inhibition of immunological memory and T-independent humoral responses by monoclonal antibodies specific for murine complement receptors. Eur J Immunol. 1991; 21(10):2501-2506. (Clone-specific: Inhibition, In vivo exacerbation). View Reference
  15. Yoshida K, van den Berg TK, Dijkstra CD. Two functionally different follicular dendritic cells in secondary lymphoid follicles of mouse spleen, as revealed by CR1/2 and FcR gamma II-mediated immune-complex trapping. Immunology. 1993; 80(1):34-39. (Clone-specific: Inhibition). View Reference
View All (15) View Less
940156 Rev. 1

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

Non-IVD products are For Research Use Only. Not for use in diagnostic or therapeutic procedures.

 

23-22940-00