Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD140a

BD™ AbSeq Oligo Rat Anti-Mouse CD140a

Clone APA5 (RUO)

940149
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Pdgfra; Pdgfr2; PDGF-R alpha; Platelet derived growth factor receptor alpha
18595
2 µl
Rat WF, also known as Wistar Furth IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TCATTAGCATTGGGTTCGATATTGTTAGCAGGCCTT
AMM2045
Mouse PDGF Receptor α chain
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940149 Rev. 2
Antibody Details
Down Arrow
APA5

The APA5 antibody monoclonal antibody specifically binds to CD140a, the Platelet-Derived Growth Factor Receptor alpha chain (PDGFR-a, PDGFR-α). CD140a is a receptor tyrosine kinase that is widely expressed on cells of mesenchymal origin in the embryo and adult. CD140a is expressed on several other cell types during embryonic development, but not on hematopoietic cells. CD140a binds to PDGF A and B chains, in contrast to PDGFR-b (CD140b) that binds only to the PDGF B chain.  Biologically active PDGF is a disulphide-linked dimer, forming the AA, AB, and BB isoforms. Ligand binding to the PDGF Receptor induces the formation of receptor dimers (aa, ab, or bb), autophosphorylation, and internalization.  The APA5 antibody has been demonstrated to block binding of  PDGF-AA to PDGFR-a-expressing cells in vitro  and to block some PDGF-mediated developmental events in vivo.

940149 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940149 Rev.2
Citations & References
Down Arrow

Development References (3)

  1. Fruttiger M, Calver AR, Krüger WH. PDGF mediates a neuron-astrocyte interaction in the developing retina. Neuron. 1996; 17(6):1117-1131. (Clone-specific: Blocking). View Reference
  2. Heldin CH. Structural and functional studies on platelet-derived growth factor. EMBO J. 1992; 11(12):4251-4259. (Biology). View Reference
  3. Takakura N, Yoshida H, Kunisada T, Nishikawa S, Nishikawa SI. Involvement of platelet-derived growth factor receptor-alpha in hair canal formation. J Invest Dermatol. 1996; 107(5):770-777. (Immunogen: Blocking, ELISA, Immunohistochemistry, Inhibition, Western blot). View Reference
940149 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.