Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD119

BD™ AbSeq Oligo Rat Anti-Mouse CD119

Clone GR20

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Ifngr1; IFN-γ Receptor α; IFN-gamma R alpha; Ifngr; INF-g Receptor; Cd119
15979
2 µl
Rat BN, also known as Brown Norway IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATTGAGAGTCGTTTGGATTTATAGGCCGTTGGTCGT
AMM2171
BALB/c mouse monomyelocytic cell line WEHI-3
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940417 Rev. 2
Antibody Details
Down Arrow Up Arrow
GR20

The GR20 monoclonal antibody specifically binds to CD119, the α chain of the interferon γ (IFN-γ) receptor. This receptor is expressed by mouse leukocytes, endothelial, and epithelial cells, but not by mature erythrocytes.  GR20 mAb recognizes an epitope (susceptible to certain fixatives) in the ligand-binding site of the receptor.  It can block the binding of mouse IFN-γ; therefore, it can inhibit IFN-γ .mediated effects including the activation of mouse macrophages for tumor cell killing.  IFN-γ has been reported to induce the expression of Ly-6A/E antigen on cell lines and normal B lymphocytes, and the GR20 antibody is capable of inhibiting the IFN-γ.induced expression of Ly-6A/E on the mouse B lymphoma line A20. The binding of the GR20 antibody to CD119 is inhibited by IFN-γ.  This antibody reportedly does not have any agonist effect.

940417 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940417 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (4)

  1. Basu M, Pace JL, Pinson DM, Hayes MP, Trotta PP, Russell SW. Purification and partial characterization of a receptor protein for mouse interferon gamma. Proc Natl Acad Sci U S A. 1988; 85(17):6282-6286. (Immunogen). View Reference
  2. Codias EK, Malek TR. Regulation of B lymphocyte responses to IL-4 and IFN-gamma by activation through Ly-6A/E molecules. J Immunol. 1990; 144(6):2197-2204. (Biology). View Reference
  3. Cofano F, Moore SK, Tanaka S, Yuhki N, Landolfo S, Appella E. Affinity purification, peptide analysis, and cDNA sequence of the mouse interferon gamma receptor. J Biol Chem. 1990; 265(7):4064-4071. (Biology). View Reference
  4. LeClaire RD, Basu M, Pinson DM, et al. Characterization and use of monoclonal and polyclonal antibodies against the mouse interferon-gamma receptor.. J Leukoc Biol. 1992; 51(5):507-16. (Biology). View Reference
940417 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.