Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD102

Oligo Rat Anti-Mouse CD102

Clone 3C4(mIC2/4)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
ICAM-2
15896
2 µl
Rat LEW, also known as Lewis IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CGTATAGGTAGGATCGATGAAGTGGTAGTTAGCGTT
AMM2098
Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Illumina is a trademark of Illumina, Inc.
  8. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
940202 Rev. 1
Antibody Details
Down Arrow Up Arrow
3C4(mIC2/4)

The 3C4 (mIC2/4) monoclonal antibody specifically binds to the mouse ICAM-2 (CD102) cell surface glycoprotein, a ligand for LFA-1. CD102 is constitutively expressed on endothelial cells, T and B lymphocytes, and alveolar walls. It is also expressed on a variety of leukocyte cell lines. CD102 does not appear to be involved in the development of hematopoietic cells. In a model for allergic asthma, endothelial CD102 mediates the transmigration of eosinophils (but not lymphocytes, monocytes, or macrophages) into the airway lumen. The 3C4 (mIC2/4) antibody blocks interactions between ICAM-2 and LFA-1.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE:  The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

940202 Rev. 1
Format Details
Down Arrow Up Arrow
Antibody-Oligo
Antibody-Oligo
940202 Rev.1
Citations & References
Down Arrow Up Arrow

Development References (3)

  1. Gerwin N, Gonzalo JA, Lloyd C, et al. Prolonged eosinophil accumulation in allergic lung interstitium of ICAM-2 deficient mice results in extended hyperresponsiveness. Immunity. 1999; 10(1):9-19. (Clone-specific). View Reference
  2. Xu H, Bickford JK, Luther E, Carpenito C, Takei F, Springer TA. Characterization of murine intercellular adhesion molecule-2. J Immunol. 1996; 156(12):4909-4914. (Immunogen). View Reference
  3. Xu H, Tong IL, De Fougerolles AR, Springer TA. Isolation, characterization, and expression of mouse ICAM-2 complementary and genomic DNA. J Immunol. 1999; 149(8):2650-2655. (Biology). View Reference
940202 Rev. 1

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.