Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse Vß 5.1, 5.2 T-Cell Receptor

Oligo Mouse Anti-Mouse Vß 5.1, 5.2 T-Cell Receptor

Clone MR9-4

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
TCR Vβ5.1/5.2; Vβ5 T-cell receptor; T cell receptor beta 5
21577
2 µl
Mouse SWR IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGGGTAGTGTTGTAGACGTGTGCGGTAAGGATAAGG
AMM2092
Mouse T-Cell Hybridoma 2HB51.8
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Illumina is a trademark of Illumina, Inc.
  8. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
940196 Rev. 1
Antibody Details
Down Arrow Up Arrow
MR9-4

The MR9-4 monoclonal antibody specifically recognizes the Vβ 5.1 and Vβ 5.2 T-cell Receptors of strains having the b haplotype (e.g., C57BL) of the Tcrb gene complex. These gene loci are deleted in mice having the a (e.g., C57BR, C57L, SJL, SWR) or c (e.g., RIII) Tcrb haplotype. Vβ5.1 and 5.2 TCR-bearing T lymphocytes are clonally eliminated, either completely or partially, in mice expressing I-E and superantigens encoded by the Mtv-1 (Mls-4a, Mlsc), Mtv-3 (Mlsc), Mtv-8 (Mlsf), Mtv-9 (Etc-1, Mlsf), Mtv-11 (Mlsf), Mtv-13 (Mls-2a, Mlsc), Mtv-27, Mtv44 , and/or Mtv-MAI endogenous provirus (e.g., A, AKR, BALB/c, C3H/He, C58, CBA/Ca, CBA/J, DBA/2, NZB, NZW). Activation of Vβ5 TCR-expressing T cells by this determinant is dependent upon presentation by I-E. Plate-bound MR9-4 antibody activates Vβ5.1 or 5.2 TCR-bearing T cells.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE:  The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

940196 Rev. 1
Format Details
Down Arrow Up Arrow
Antibody-Oligo
Antibody-Oligo
940196 Rev.1
Citations & References
Down Arrow Up Arrow

Development References (9)

  1. Behlke MA, Chou HS, Huppi K, Loh DY. Murine T-cell receptor mutants with deletions of beta-chain variable region genes. Proc Natl Acad Sci U S A. 1986; 83(3):767-771. (Biology). View Reference
  2. Bill J, Kanagawa O, Linten J, Utsunomiya Y, Palmer E. Class I and class II MHC gene products differentially affect the fate of V beta 5 bearing thymocytes. J Mol Cell Immunol. 1990; 4(5):269-280. (Immunogen). View Reference
  3. Haqqi TM, Banerjee S, Anderson GD, David CS. RIII S/J (H-2r). An inbred mouse strain with a massive deletion of T cell receptor V beta genes. J Exp Med. 1989; 169(6):1903-1909. (Biology). View Reference
  4. Hodes RJ, Abe R. Mouse endogenous superantigens: Ms and Mls-like determinants encoded by mouse retroviruses.. Curr Protoc Immunol. 2001; Appendix 1:Appendix 1F. (Biology). View Reference
  5. Hugin AW, Vacchio MS, Morse HC 3rd. A virus-encoded "superantigen" in a retrovirus-induced immunodeficiency syndrome of mice. Science. 1991; 252(5004):424-427. (Biology). View Reference
  6. Tomonari K, Fairchild S, Rosenwasser OA. Influence of viral superantigens on V beta- and V alpha-specific positive and negative selection. Immunol Rev. 1993; 131:131-168. (Biology). View Reference
  7. Utsunomiya Y, Kosaka H, Kanagawa O. Differential reactivity of V beta 9 T cells to minor lymphocyte stimulating antigen in vitro and in vivo. Eur J Immunol. 1991; 21(4):1007-1011. (Biology). View Reference
  8. Woodland D, Happ MP, Bill J, Palmer E. Requirement for cotolerogenic gene products in the clonal deletion of I-E reactive T cells. Science. 1990; 247(4945):964-967. (Biology). View Reference
  9. Woodland DL, Happ MP, Gollob KJ, Palmer E. An endogenous retrovirus mediating deletion of alpha beta T cells. Nature. 1991; 349(6309):529-530. (Biology). View Reference
View All (9) View Less
940196 Rev. 1

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

Non-IVD products are For Research Use Only. Not for use in diagnostic or therapeutic procedures.

 

23-22940-00