Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD81 (TAPA-1)

BD™ AbSeq Oligo Mouse Anti-Human CD81 (TAPA-1)

Clone JS-81 (also known as JS81)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
TAPA1; Tetraspanin-28; Tspan-28; TSPAN28; CVID6; S5.7; M38
975
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTAGATTGACGGTCGAAGAGTTACGCCTGATTGTGT
AHS0021
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940052 Rev. 3
Antibody Details
Down Arrow Up Arrow
JS-81

The JS-81 monoclonal antibody specifically binds to CD81, which is also known as, Target of the antiproliferative antibody 1 (TAPA1, TAPA-1), or Tetraspanin-28 (Tspan-28/TSPAN28). CD81 is an ~26 kDa transmembrane protein that belongs to the tetraspanin (TM4SF) family. It is involved in cell growth and signal transduction. CD81 has a very broad cellular distribution, being expressed on cells of hematopoietic, neuroectodermal and mesenchymal origin. In hematopoietic cells, the CD81 antigen is expressed on B and T lymphocytes, NK cells, thymocytes, eosinophils, germinal center follicular dendritic cells, and to a variable extent on monocytes. The CD81 antigen is not expressed on neutrophils, platelets, or erythrocytes. CD81-specific antibodies have been shown to have anti-proliferative effects on different lymphoid cell lines, particularly those derived from large cell lymphomas. They are also reported to induce homotypic cell aggregation. Immunoprecipitation studies reveal that CD81 is a component of a multimolecular complex of CD19, CD21, and CD225 that is involved in the activation and control of B cell growth.

940052 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940052 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (7)

  1. Bradbury LE, Kansas GS, Levy S, Evans RL, Tedder TF. The CD19/CD21 signal transducing complex of human B lymphocytes includes the target of antiproliferative antibody-1 and Leu-13 molecules. J Immunol. 1992; 149(9):2841-2850. (Biology). View Reference
  2. Carloni V, Mazzocca A, Ravichandran KS. Tetraspanin CD81 is linked to ERK/MAPKinase signaling by Shc in liver tumor cells. Oncogene. 2004; 23(8):1566-1574. (Clone-specific: Flow cytometry, Immunofluorescence, Immunoprecipitation). View Reference
  3. Levy S, Todd SC, Maecker HT. CD81 (TAPA-1): a molecule involved in signal transduction and cell adhesion in the immune system. Annu Rev Immunol. 1998; 16:89-109. (Clone-specific). View Reference
  4. Mazzocca A, Sciammetta SC, Carloni V, et al. Binding of hepatitis C virus envelope protein E2 to CD81 up-regulates matrix metalloproteinase-2 in human hepatic stellate cells. J Biol Chem. 2005; 280(12):11329-11339. (Clone-specific: Blocking, Flow cytometry, Functional assay, Inhibition, Neutralization). View Reference
  5. Oren R, Takahashi S, Doss C, Levy R, Levy S. TAPA-1, the target of an antiproliferative antibody, defines a new family of transmembrane proteins. Mol Cell Biol. 1990; 10(8):4007-4015. (Biology). View Reference
  6. Schick MR, Levy S. The TAPA-1 molecule is associated on the surface of B cells with HLA-DR molecules. J Immunol. 1993; 151(8):4090-4097. (Biology). View Reference
  7. Tedder TF, Wagner N, Engel P. CD81 Workshop report. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:684-688.
View All (7) View Less
940052 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.