Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD69

Oligo Mouse Anti-Human CD69

Clone FN50 (also known as FN 50)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
AIM; CLEC2C; EA1; GP32/28; Leu23; MLR-3; VEA; BL-AC/P26
969
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CAATAACGGGTCATAGTAAGTCGCGAGTAAGAGGGC
AHS0010
Anti-µ stimulated human B lymphocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Illumina is a trademark of Illumina, Inc.
940019 Rev. 2
Antibody Details
Down Arrow Up Arrow
FN50

The FN50 monoclonal antibody specifically binds to human CD69. CD69 is also known as activation-induced molecule (AIM), early activation antigen (EA-1), very early activation antigen (VEA), C-type lectin domain family 2 member C (CLEC2C), MLR-3, GP32/28 and Leu-23. CD69 is a transmembrane type II homodimer receptor. CD69 is comprised of disulfide-linked, differentially glycosylated core protein subunits that are approximately 28 and 34 kDa in size. Each subunit contains a C-type lectin domain.  CD69 is expressed on activated T, B, and natural killer (NK) lymphocytes, thymocytes, neutrophils, eosinophils and platelets. In normal peripheral blood, a small and variable percentage of lymphocytes typically express detectable membrane CD69 antigen. Upon activation, CD69 antigen expression increases on lymphocytes. Peak CD69 expression generally occurs within 18 hours of activation, preceding the appearance of HLA-DR, IL-2Rα (CD25) and transferrin receptor (CD71). CD69 is highly expressed on the bright CD3+ subset of thymocytes. FN50 monoclonal antibody labels NK cells and most lymphocytes of the follicular mantle and perifollicular/interfollicular zone as well as germinal center T cells of lymph nodes and tonsils. Studies indicate that CD69 serves as a signaling receptor in the activation of a variety of cell types.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system or other oligo-dT-based capture systems. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

940019 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
Antibody-Oligo
940019 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (8)

  1. CD69. In: Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007:161.
  2. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  3. Lin G-X, Yang X, Hollemweguer E, et al. Cross-reactivity of CD antibodies in eight animal species. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:519-523.
  4. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  5. Schwarting R, Biedobitek G, Stein H. Cluster report: CD69. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:428-429.
  6. Stein H, Schwarting R, Niedobitek G, Dallenbach F. Activation Section Report. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:387-398.
  7. Tomescu C, Chehimi J, Maino VC, Montaner LJ. NK cell lysis of HIV-1-infected autologous CD4 primary T cells: requirement for IFN-mediated NK activation by plasmacytoid dendritic cells. 2007; 179(4):2097-2104. (Clone-specific: Flow cytometry). View Reference
  8. Yoshino N, Ami Y, Terao K, Tashiro F, Honda M. Upgrading of flow cytometric analysis for absolute counts, cytokines and other antigenic molecules of cynomolgus monkeys (Macaca fascicularis) by using anti-human cross-reactive antibodies. Exp Anim. 2000; 49(2):97-110. (Clone-specific: Flow cytometry). View Reference
View All (8) View Less
940019 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.