Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD45RO

BD™ AbSeq Oligo Mouse Anti-Human CD45RO

Clone UCHL1 (RUO)

940022
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
CD45R; PTPRC; LCA; Leukocyte common antigen; GP180; LY5; T200
5788
2 µl
Mouse BALB/c IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGAGAGGTTATTGGGCGTATGACTTCGGTGATTGTG
AHS0036
Human IL-2-dependent T-cell line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940022 Rev. 3
Antibody Details
Down Arrow
UCHL1

The UCHL1 monoclonal antibody specifically binds to the 180 kDa isoform of CD45 (aka, the Leukocyte Common Antigen). CD45RO is a type I transmembrane glycoprotein that has cytoplasmic protein tyrosine phosphatase activity and functions in signal transduction pathways. This CD45 isoform does not include amino acid sequences encoded by the variable CD45 exons A, B, or C. CD45RO is expressed on most thymocytes, activated T cells, memory T cells, granulocytes and monocytes, but only on a proportion of resting T cells. CD45RO and CD45RA antibodies seem to define complementary, predominantly non-overlapping, populations in resting peripheral T cells, demonstrating heterogeneity within the CD8 and CD4 subpopulations. CD45RO binds to CD22.

940022 Rev. 3
Citations & References
Down Arrow

Development References (6)

  1. Akbar AN, Terry L, Timms A, Beverley PC, Janossy G. Loss of CD45R and gain of UCHL1 reactivity is a feature of primed T cells. J Immunol. 1988; 140(7):2171-2178. (Clone-specific: Flow cytometry). View Reference
  2. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  3. Norton AJ, Ramsay AD, Smith SH, Beverley PC, Isaacson PG. Monoclonal antibody (UCHL1) that recognises normal and neoplastic T cells in routinely fixed tissues. J Clin Pathol. 1986; 39(4):399-405. (Immunogen: Immunohistochemistry). View Reference
  4. Smith SH, Brown MH, Rowe D, Callard RE, Beverley PC. Functional subsets of human helper-inducer cells defined by a new monoclonal antibody, UCHL1. Immunology. 1986; 58(1):63-70. (Clone-specific: Flow cytometry, Immunohistochemistry, Immunoprecipitation). View Reference
  5. Streuli M, Morimoto C, Schrieber M, Schlossman SF, Saito H. Characterization of CD45 and CD45R monoclonal antibodies using transfected mouse cell lines that express individual human leukocyte common antigens. J Immunol. 1988; 141(11):3910-3914. (Clone-specific: Flow cytometry). View Reference
  6. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
View All (6) View Less
940022 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.