Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD44

BD™ AbSeq Oligo Mouse Anti-Human CD44

Clone L178

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Pgp-1; H-CAM; Hermes; ECMR-III; HUTCH-1; gp80-95; Ly-24; CSPG8; HCELL
960
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTGATTGATTAGGACAGTTCGTTGCTTAGTAGTGGG
AHS0167
Human TCR γδ+ Thymocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940251 Rev. 2
Antibody Details
Down Arrow Up Arrow
L178

The L178 monoclonal antibody specifically binds to CD44 which is also known as Homing-associated cell adhesion molecule (H-CAM) or Phagocytic glycoprotein 1 (Pgp-1). CD44 is a single-pass type I transmembrane glycoprotein that exists in a variety of isoforms also known as variant CD44 (CD44v) or CD44R forms. CD44 is synthesized as a 37 kDa polypeptide that is converted to an 80-95 kDa form by glycosylation via N- and O-linkages, or to a 180-200 kDa form by the addition of chondroitin sulfate. It is expressed on leucocytes, erythrocytes, epithelial cells and weakly on platelets. Depending on the cell type, CD44 may participate in a variety of functions including cell adhesion, motility and cell activation.

940251 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940251 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940251" on CiteAb

Development References (9)

  1. Brown TA, Bouchard T, St John T, Wayner E, Carter WG. Human keratinocytes express a new CD44 core protein (CD44E) as a heparan-sulfate intrinsic membrane proteoglycan with additional exons. J Cell Biol. 1991 April; 113(1):207-221. (Biology). View Reference
  2. Carter WG, Wayner EA. Characterization of the class III collagen receptor, a phosphorylated, transmembrane glycoprotein expressed in nucleated human cells. J Biol Chem. 1998 March; 263(9):4193-4201. (Biology). View Reference
  3. Denning SM, Le PT, Singer KH, Haynes BF. Antibodies against the CD44 p80, lymphocyte homing receptor molecule augment human peripheral blood T cell activation.. J Immunol. 1990 January; 144(1):7-15. (Biology). View Reference
  4. Denning SM, Telen MJ, Hale LP, Liao HX, Haynes BF. CD44 and CD44R Cluster Report . In: :1713-1719. View Reference
  5. Gallatin WM, Wayner EA, Hoffman PA, St John T, Butcher EC, Carter WG. Structural homology between lymphocyte receptors for high endothelium and class III extracellular matrix receptor. Proc Natl Acad Sci U S A. 1989 June; 86(12):4654-4658. (Biology). View Reference
  6. Jalkanen S, Jalkanen M, Bargatze R, Tammi M, Butcher EC. Biochemical properties of glycoproteins involved in lymphocyte recognition of high endothelial venules in man. J Immunol. 1988 September; 141(5):1615-1623. (Biology). View Reference
  7. Nagler A, Lanier LL, Cwirla S, Phillips JH. Comparative studies of human FcRIII-positive and negative natural killer cells.. J Immunol. 1989; 143(10):3183-91. (Clone-specific: Flow cytometry). View Reference
  8. Shimizu Y, Van Seventer GA, Siraganian R, Wahl L, Shaw S. Dual role of the CD44 molecule in T cell adhesion and activation. J Immunol. 1989 October; 143(8):2457-2463. (Biology). View Reference
  9. St John T, Meyer J, Idzerda R, Gallatin WM. Expression of CD44 confers a new adhesive phenotype on transfected cells. Cell. 1990 January; 60(1):45-52. (Biology). View Reference
View All (9) View Less
940251 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.