Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD38

BD™ AbSeq Oligo Mouse Anti-Human CD38

Clone HIT2

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
T10; ADP-ribosyl cyclase 1; Cyclic ADP-ribose hydrolase 1; gp45
952
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTCAACGATGGGTAGCGGTAGAAATAACGGAACTGG
AHS0022
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940013 Rev. 3
Antibody Details
Down Arrow Up Arrow
HIT2

The HIT2 monoclonal antibody specifically binds to CD38. The CD38 antigen is also known as T10, ADP-ribosyl cyclase 1, and cyclic ADP ribose hydrolase 1. CD38 is a 45 kDa type II single-chain transmembrane glycoprotein present on thymocytes, activated T cells and terminally differentiated B cells (plasma cells). CD38 is expressed by other cells including monocytes, macrophages, dendritic cells, NK cells, myeloid and erythroid precursors and some epithelial cells. The CD38 antigen acts as an ectoenzyme that catalyzes the synthesis and hydrolysis of a Ca++ mobilizing agent, cyclic ADP-ribose. This intracellular calcium plays an important role in cell signaling pathways leading to cellular growth, apoptosis, and differentiation. CD38 binds to CD31 and thus plays a role in lymphocyte adhesion to endothelial cells.

940013 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940013 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940013" on CiteAb

Development References (10)

  1. Deaglio S, Morra M, Mallone R, et al. Human CD38 (ADP-ribosyl cyclase) is a counter-receptor of CD31, an Ig superfamily member. J Immunol. 1998; 160(1):395-402. (Biology). View Reference
  2. Dörken B, Möller P, Pezzutto A, Schwartz-Albiez R, Moldenhauer G. B-cell antigens: CD38. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:86.
  3. Hernandez-Lopez C, Varas A, Sacedon R, et al. Stromal cell-derived factor 1/CXCR4 signaling is critical for early human T-cell development. Blood. 2002; 99(2):546-554. (Clone-specific: Flow cytometry). View Reference
  4. Jackson DG, Bell JI. Isolation of a cDNA encoding the human CD38 (T10) molecule, a cell surface glycoprotein with an unusual discontinuous pattern of expression during lymphocyte differentiation. J Immunol. 1990; 144(7):2811-2815. (Clone-specific: Cell separation, Immunoprecipitation). View Reference
  5. Jourdan M, Caraux A, Caron G, et al. Characterization of a transitional preplasmablast population in the process of human B cell to plasma cell differentiation. J Immunol. 2011; 187(8):3931-3941. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
  6. Lanier LL, Le AM, Ding AH, Evans EL. Analysis of the Workshop T-cell monoclonal antibodies by 'Indirect two-colour immunofluorescense' and multiparameter flow cytometry. In: McMichael AJ. A.J. McMichael .. et al., ed. Leucocyte typing III : white cell differentiation antigens. Oxford New York: Oxford University Press; 1987:62-68.
  7. McMichael AJ, Gotch FM. T-cell antigens: new and previously defined clusters. In: McMichael AJ. A.J. McMichael .. et al., ed. Leucocyte typing III : white cell differentiation antigens. Oxford New York: Oxford University Press; 1987:31-62.
  8. Roy MP, Kim CH, Butcher EC. Cytokine control of memory B cell homing machinery. J Immunol. 2002; 169(4):1676-1682. (Clone-specific: Flow cytometry). View Reference
  9. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  10. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
View All (10) View Less
940013 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.