Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD30

BD™ AbSeq Oligo Mouse Anti-Human CD30

Clone BerH8 (also known as Ber-H8)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
TNFRSF8; TNR8; CD30L/CD153 receptor; Ki-1; D1S166E
943
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CCAGTGTAGATTGAGCCGTCGATTTAGTTAGCAGTG
AHS0114
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940103 Rev. 3
Antibody Details
Down Arrow Up Arrow
BerH8

The BerH8 monoclonal antibody specifically binds to CD30, a 120 kDa type I transmembrane glycoprotein expressed on stimulated T and B cells. CD30 is an activation marker initially identified to be expressed on Reed-Sternberg cells. It is also expressed on a few extrafollicular T and B cells located at the rim of germinal centers. CD30 serves as a cytokine receptor. It belongs to the nerve growth factor receptor/tumor necrosis factor receptor (NGFR/TNFR) superfamily and is also known as TNFRSF8. CD30 interaction with CD30 ligand (CD30L/CD153/TNFSF8) can mediate signals for proliferation, apoptosis and cytotoxicity of lymphoid cells.

940103 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940103 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (6)

  1. Beverly PCL. Activation antigens: new and previously defined clusters. In: McMichael AJ. A.J. McMichael .. et al., ed. Leucocyte typing III : white cell differentiation antigens. Oxford New York: Oxford University Press; 1987:516-524.
  2. Bowen MA, Olsen KJ, Cheng L, Avila D, Podack ER. Functional effects of CD30 on a large granular lymphoma cell line, YT. Inhibition of cytotoxicity, regulation of CD28 and IL-2R, and induction of homotypic aggregation. J Immunol. 1993; 151(11):5896-5906. (Biology). View Reference
  3. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  4. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  5. Schwarting R, Stein H. Cluster report CD30. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:419-422.
  6. Stein H, Schwarting R, Niedobitek G, Dallenbach F. Activation Section Report. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:387-398.
View All (6) View Less
940103 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.