Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD226

Oligo Mouse Anti-Human CD226

Clone DX11

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
DNAM-1; DNAM1; PTA1; PTA-1; TLiSA1
10666
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GAGTTTATGATTCGTTTCTTCGGTAGTTCGTCGCTT
AHS0079
Human CTL Clone
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Illumina is a trademark of Illumina, Inc.
940075 Rev. 3
Antibody Details
Down Arrow Up Arrow
DX11

The DX11 monoclonal antibody specifically binds to CD226 which is also known as DNAX accessory molecule-1 (DNAM-1), Platelet and T cell activation antigen 1 (PTA1), or T lineage-specific activation antigen 1 antigen (TLiSA1). CD226 is a 65 kDa type 1 transmembrane glycoprotein consisting of 318 amino acid residues including two Ig-like domains. CD226 is expressed on the majority of T cells, NK cells, monocytes, platelets, and a subset of B cells, but not on erythrocytes. It is also present on a subset of thymocytes coexpressing high density surface CD3. CD226 is not present on normal fibroblast cell lines or tumor cell lines of epithelial or neuronal origins. CD226 is a tyrosine phosphorylated, signal-transducing molecule which participates in primary adhesion during cytotoxic T lymphocyte (CTL)- or NK cell-mediated cytotoxicity. The DX11 antibody inhibits T- and NK cell-mediated cytotoxicity against a variety of tumor cell targets, and blocks cytokine production by alloantigen-specific T cells.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system or other oligo-dT-based capture systems. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

940075 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
Antibody-Oligo
940075 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (4)

  1. Lanier LL, Shibuya A, Burns G. CD226 (DNAM-1, PTA1, Tlisa). In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:921-922.
  2. Shibuya A, Campbell D, Hannum C, et al. DNAM-1, a novel adhesion molecule involved in the cytolytic function of T lymphocytes. Immunity. 1996; 4(6):573-581. (Immunogen: Bioassay, Blocking, Flow cytometry, Functional assay, Immunoaffinity chromatography, Inhibition, Western blot). View Reference
  3. Shibuya A, Lanier LL, Phillips JH. Protein kinase C is involved in the regulation of both signaling and adhesion mediated by DNAX accessory molecule-1 receptor. J Immunol. 1998; 161(4):1671-1676. (Clone-specific: Bioassay, Blocking, Cytotoxicity, Flow cytometry, Functional assay, Immunoprecipitation). View Reference
  4. Zola H, Swart B, Boumsell L, Mason DY. Human Leucocyte Differentiation Antigen nomenclature: update on CD nomenclature. Report of IUIS/WHO Subcommittee.. J Immunol Methods. 2003; 275(1-2):1-8. (Clone-specific: Flow cytometry). View Reference
940075 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.