Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD16b

BD™ AbSeq Oligo Mouse Anti-Human CD16b

Clone CLB-gran11.5

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
FCGR3B; FCRIIIb; FcγIIIB
2215
2 µl
Mouse BALB/c IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TATTGGGCTGCTAGTGTATTGACCGAAAGACGTATG
AHS0268
Human Granulocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940389 Rev. 2
Antibody Details
Down Arrow Up Arrow
CLB-gran11.5

Reacts with CD16b, a glycosyl phosphatidyl inositol-anchored (GPI) protein expressed on human neutrophils. Human CD16 is the low affinity Fc gamma receptor III (Fc gamma RIII) and shows two distinct forms coded by two linked genes. One form is CD16a, a polypeptide-anchored form (Fc gamma RIIIA), present on natural killer cells and macrophages. The other form is CD16b the GPI-anchored form, Fc gamma RIIIB, found on human neutrophils. CD16b is polymorphic and the two codominant alleles are referred to as Neutrophil Antigen 1 (NA1) and Neutrophil Antigen 2 (NA2). Clone CLBgran11.5 reacts with neutrophils expressing the NA1 molecule. CD16b has been reported to participate in immune complex binding by resting neutrophils and also in  neutrophil transendothelial migration by interacting with integrins during the inflammation response process.

940389 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940389 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (4)

  1. Nagarajan S, Anderson M, Ahmed SN, Sell KW, Selvaraj P. Purification and optimization of functional reconstitution on the surface of leukemic cell lines of GPI-anchored Fc gamma receptor III. J Immunol Methods. 1995; 184(2):241-251. (Biology). View Reference
  2. Nagarajan S, Chesla S, Cobern L, Anderson P, Zhu C, Selvaraj P. Ligand binding and phagocytosis by CD16 (Fc gamma receptor III) isoforms. Phagocytic signaling by associated zeta and gamma subunits in Chinese hamster ovary cells. J Biol Chem. 1995; 270(43):25762-25770. (Biology). View Reference
  3. Nagarajan S, Venkiteswaran K, Anderson M, Sayed U, Zhu C, Selvaraj P. Cell-specific, activation-dependent regulation of neutrophil CD32A ligand-binding function. Blood. 2000; 95(3):1069-1077. (Biology). View Reference
  4. Sendo F, Suzuki K, Watanabe T, Takeda Y, Araki Y. Modulation of leukocyte transendothelial migration by integrin-associated glycosyl phosphatidyl inositol (GPI)-anchored proteins. Inflamm Res. 1998; 47(3):S133-S136. (Biology). View Reference
940389 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.