Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD14

BD™ AbSeq Oligo Mouse Anti-Human CD14

Clone MφP9 (also known as MφP-9)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
LPS receptor; LPS-R; Myeloid cell-specific leucine-rich glycoprotein
2 µl
Mouse BALB/c IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGGCCCGTGGTAGCGCAATGTGAGATCGTAATAAGT
AHS0037
Human Monocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940005 Rev. 3
Antibody Details
Down Arrow Up Arrow
MφP9

The MΦP9 monoclonal antibody specifically binds to CD14. CD14 is a 53-55 kDa glycosylphosphatidylinositol (GPI)-anchored and single chain glycoprotein expressed at high levels on monocytes. Additionally, this CD14-specific antibody reacts with interfollicular macrophages, reticular dendritic cells and some Langerhans cells. CD14 has been identified as a high affinity cell-surface receptor for complexes of lipopolysaccharide (LPS) and serum LPS-binding protein, LPB. This antibody is suitable for staining acetone-fixed, frozen tissue sections.

940005 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940005 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (4)

  1. Dimitriu-Bona A, Burmester GR, Kelley K, Winchester RJ. Human mononuclear phagocyte differentiation antigens: Definition by monoclonal antibodies, cell distribution, and in vitro modulation. In: Bernard A, Boumsell L, Dausset J, Milstein C, Schlossman SF, ed. Leukocyte Typing. New York: Springer-Verlag; 1984:434-437.
  2. Dimitriu-Bona A, Burmester GR, Waters SJ, Winchester RJ. Human mononuclear phagocyte differentiation antigens. I. Patterns of antigenic expression on the surface of human monocytes and macrophages defined by monoclonal antibodies. J Immunol. 1983; 130(1):145-152. (Immunogen: Flow cytometry, Immunofluorescence). View Reference
  3. Goyert SM, Ferrero E. Biochemical analysis of myeloid antigens and cDNA expression of gp55 (CD14). In: McMichael AJ. A.J. McMichael .. et al., ed. Leucocyte typing III : white cell differentiation antigens. Oxford New York: Oxford University Press; 1987:613-619.
  4. Wright SD, Ramos RA, Tobias PS, Ulevitch RJ, Mathison JC. CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science. 1990; 249(4975):1431-1433. (Biology). View Reference
940005 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.