Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD123 (IL-3 Receptor α)

Oligo Mouse Anti-Human CD123 (IL-3 Receptor α)

Clone 7G3

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
IL3RA; IL-3RA; IL-3Rα; IL-3R-alpha; Interleukin-3 receptor subunit alpha
3563
2 µl
Mouse IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ACAGTTTAGTAGGACGTGAGGTATCGCGAGAATGCC
AHS0020
Human IL-3Ra-transfected cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Illumina is a trademark of Illumina, Inc.
940020 Rev. 2
Antibody Details
Down Arrow Up Arrow
7G3

The 7G3 monoclonal antibody specifically recognizes human CD123, the 70 kDa IL-3 Receptor α (IL-3Rα) chain. CD123 associates with CD131, the 120-140 kDa Common β chain to form the IL-3 Receptor Complex. CD131 is shared with the receptors for interleukins IL-5 and GM-CSF. IL-3Rα is expressed on hematopoietic progenitors and plays an important role in hematopoietic progenitor cell growth and differentiation. It is also expressed by mast cells, macrophages and a CD5+ B cell subset. This antibody has been reported to block the binding of 125I-IL-3 to high and low affinity IL-3 receptors. In functional experiments, this antibody was found to inhibit acute myeloid leukemia cell proliferation, basophil histamine release, endothelial cell-mediated IL-8 secretion, and neutrophil transmigration. This antibody has been reported to be useful for immunoprecipitation, Western blot and immunofluorescent staining for flow cytometry. At the Fifth HLDA Workshop, the human IL-3 receptor was designated CD123.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system or other oligo-dT-based capture systems. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

940020 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
Antibody-Oligo
940020 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (5)

  1. Korpelainen EI, Gamble JR, Smith WB, et al. The receptor for interleukin 3 is selectively induced in human endothelial cells by tumor necrosis factor alpha and potentiates interleukin 8 secretion and neutrophil transmigration.. Proc Natl Acad Sci USA. 1993; 90(23):11137-41. (Biology). View Reference
  2. Macardle PJ, Chen Z, Shih CY, et al. Characterization of human leucocytes bearing the IL-3 receptor. Cell Immunol. 1996; 168(1):59-68. (Clone-specific: Flow cytometry, Fluorescence microscopy, Immunofluorescence). View Reference
  3. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  4. Smith WB, Guida L, Sun Q, et al. Neutrophils activated by granulocyte-macrophage colony-stimulating factor express receptors for interleukin-3 which mediate class II expression. Blood. 1995; 86(10):3938-3944. (Clone-specific: Flow cytometry, Functional assay, Inhibition). View Reference
  5. Sun Q, Woodcock JM, Rapoport A, et al. Monoclonal antibody 7G3 recognizes the N-terminal domain of the human interleukin-3 (IL-3) receptor alpha-chain and functions as a specific IL-3 receptor antagonist.. Blood. 1996; 87(1):83-92. (Immunogen: Blocking, Flow cytometry, Immunoprecipitation, Neutralization). View Reference
940020 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

Non-IVD products are For Research Use Only. Not for use in diagnostic or therapeutic procedures.

 

23-22940-00